Entry information : ZmRboh01 (GRMZM2G089291)
Entry ID 6707
Creation 2009-04-12 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-01-05 (Catherine Mathe)
Peroxidase information: ZmRboh01 (GRMZM2G089291)
Name (synonym) ZmRboh01 (GRMZM2G089291)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmRboh01
start..stop
S start..stop
SbRboh 1265 0 2..666 15..677
EgrRboh07 791 0 35..666 156..796
MtRboh06 784 0 46..666 182..815
CsRboh07 750 0 40..666 170..784
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 88965838..88965927 90 N° 2 88964930..88965022 93 N° 3 88964734..88964844 111 N° 4 88964151..88964537 387
N° 5 88963683..88964069 387 N° 6 88963508..88963603 96 N° 7 88963282..88963397 116 N° 8 88963030..88963132 103
N° 9 88962752..88962919 168 N° 10 88962537..88962668 132 N° 11 88962290..88962418 129 N° 12 88961909..88961987 79
N° 13 88961290..88961399 110  
complement(join(88961290..88961399,88961909..88961987,88962290..88962418,8896253 7..88962668,88962752..88962919,88963030..88963132,88963282..88963397,88963508..8 8963603,88963683..88964069,88964151..88964537,88964734..88964844,88964930..88965 022,88965838..88965927))


exon

Literature and cross-references ZmRboh01 (GRMZM2G089291)
Literature Alexandrov,N.N., Brover,V.V., Freidin,S., Troukhan,M.E., Tatarinova,T.V., Zhang,H., Swaller,T.J., Lu,Y.P., Bouck,J., Flavell,R.B. and Feldmann,K.A. Insights into corn genes derived from large-scale cDNA sequencing. Plant Mol. Biol. 69 (1-2), 179-194 (2009).
DNA ref. GenBank:   AC231400.4 (191886..187249)
mRNA ref. GenBank:   EU952228
Cluster/Prediction ref. UniGene:   Zm.122806
Protein sequence: ZmRboh01 (GRMZM2G089291)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   666
PWM (Da):   %s   75602.13 Transmb domain:   %s   i144-163o228-247i279-301o327-349i356-374o
PI (pH):   %s   9.76
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
RWVRLEPAATVAKSPILMLRGAKIASAVVRYADQPELFTQAYLCSCDRNSTSRITGKDIKQAIMFSASLNKLTLNQDEATEYTNLILEELQTGQGVLQMNVMSKGLSRDLQPTCGPIPVPMKCSRQRHILTATVVFFQAHWRRIFVVFLWLMACAALFTWKFMQYRQRLAFEVMGYCLSTAKGAAETLKLNMAIVLLPVCRNTVTWLRRSRVINSVIPFNDNINFHKLVAAGIVIGVILHGGIHLACDFPRITRTDKAFFGRTIAADFGYHQPSYLEIVVSTEGTTGIAMVVLMFVAFLLASSPSRRNPGMLPPLVRQLAGFNAFWYSHHVFIAVYVLLIVHSMFLFLAKDVAEKTTWMYVAIPVVIYIGERMFRMVRSMVFDVKILNATVYPGMVLALKVTKPPGFRYQSGMYVFVQCPEVSKFEWHPFSLTSAPDDDHLSIHIRSLGDWSYQMYDVFQMLLSSNSSMPKIFFDGPYGAASQDHSKYEIILLIGLGIGATPFISVLKDIANGLDKGHGNLNYHSDRLKKAYFYWVTREQGSFEWFRDIMKEVSVLDSKQGVIEMYNYLTSVYQEGDKRSMLISAIQALHFARHGIDIISKTPVHTHFSRPNWPRVLHGLARRHIGERIGVFYCGPDDLGRQLEKLCHKVNTKTFTRFVFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 13 introns) and 8 ESTs. Also found in AC214496.3.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CGGTGGGTGCGCCTAGAGCCTGCAGCCACCGTAGCGAAATCTCCAATCTTGATGTTGCGCGGGGCGAAGATTGCCTCTGCCGTCGTTAGGGTCAAGCACCGAGTCGCCGGCTGCTGCCCC
CTCTCCCTATCGTCGCGCCATCCATTTCCTCGCCGTTGACGACGACGAGCGAGACTAGGGACCGGCCTTCGACGAAGTGGCGGCTACTGCTCGATCTAGCGAGGGTGGCTGGCATCGAGC
TGGGGCGGCGGCCATGAGCCATCTCTTCGACAACAGGTAGGTGGAACAGGGGCGCGGGATGAGACCATGAGAGTGCGCACAAGCGAGCTGTGGCAGGCTGGCAGCTGGCATTGGGAAAAT
CAGGCAACTCAACTTGATAGATCAAAGGATGAAGGTGCTAAATGTGACAGACGATGCAGCCGCGGATTTAACCAAACGAACTGCTAAATAATCTTACTGAAATTTTTTATTCTACTTTGT
GCGTTTGATTTCCTGTAAAAGCTGGTGGTATTATGCATTGGGATCTTTCGTTCATATCCTTTTATTGTTTCTATAATGCCTTATTAGCATATCTACACGGAAACACTTGAAGGATCCCAT
TCAAAAAATCAACTTAAACGTGATTGCTATTATGTTGAACCTGCCATACAGGTTTTGAAAAATCAACAAGAGAATGTTCAATAGTTTGAAGTCCTCAGAAATTACAAAAGCGTGTTATTA
TTTGATCTTCAAACAATTTACTTGCTCCTGCAGGTGAGAATGAATCTTACAGTTCAACCATATATCCTCTTCCGGACAATGTAAATATCAACTCCAGTAGATCGATCAGTCGGTGTCCTA
GCCATGGCATCAGAATAGCAATGGACAGGTATTCTTCCTGAATTGTGATCCCCAACTCTTTGTAGTATGCCGATCAACCAGAATTGTTTACGCAAGCATATCTTTGCAGCTGCGACAGAA
ACTCAACTAGCAGAATCACAGGGAAGGATATTAAGCAG
GTACTGTAGAAGTCATCAGTGATGTAAAACTACTTGTTATTGCTGTGGGCCTAACATGTCTCCTTATGTGCTTGTAATTTAT
CAGGCGATTATGTTCAGTGCCTCTTTGAACAAGCTCACATTAAACCAAGATGAGGCCACCGAATACACAAATTTGATCCTAGAAGAACTTCAGACAGGTCAAGGAGTCCTCCAGGTGATC
TTCTTGTAATTTAAAACAAACAGTTCTTCATAACCATGTATAATTATGCTACTATCATCTTTTAAGGCTCACTATGTCAGTACAGACCCCCCATGTTAGTAAACGCAATTGGTGGCATAT
ACAAAAGCTTGGGACTTAGCAGTACCAGATTCAAACATGTATCTCCTAGTAATTCAAATCTAATTTACAGATGAATGTCATGAGCAAGGGCCTGTCAAGGGATCTCCAACCAACCTGCGG
GCCAATACCAGTGCCAATGAAATGCAGCCGACAGCGACATATACTTACTGCAACCGTAGTCTTCTTCCAAGCTCACTGGAGGCGTATATTTGTGGTTTTCTTGTGGCTCATGGCATGTGC
TGCACTCTTCACATGGAAGTTCATGCAGTACAGACAGCGGTTGGCTTTCGAGGTAATGGGGTACTGCCTGTCGACAGCCAAGGGGGCTGCAGAGACGCTCAAGCTCAACATGGCCATTGT
GCTCCTACCTGTTTGCCGCAACACGGTCACTTGGCTCAGGAGAAGCCGTGTTATCAACTCGGTCATCCCATTTAATGACAATATTAACTTCCACAAG
GTGTGTGTCATCTTTTTTCAATC
CTGTCACGCTTTACTAGTCTGCAGATAGACTGAGTTTAACGCTCATCTTTTAGTTTAGCTTGTTGCAGCGGGAATTGTGATCGGTGTAATCCTTCATGGAGGCATCCACCTGGCATGCGA
CTTCCCAAGGATCACAAGGACAGATAAGGCCTTCTTTGGACGCACAATTGCCGCTGACTTTGGGTACCACCAGCCATCCTACCTGGAGATAGTGGTATCAACCGAGGGGACAACTGGTAT
AGCAATGGTGGTACTAATGTTTGTCGCATTCTTGCTTGCTAGTAGTCCTTCGAGAAGAAATCCAGGAATGCTGCCACCTCTCGTCAGACAGTTAGCTGGGTTCAATGCCTTCTGGTACTC
GCACCATGTGTTCATCGCTGTCTATGTGCTCCTCATTGTGCATTCCATGTTCCTATTCCTAGCAAAGGATGTAGCAGAGAAGACG
GTATGATACTACTCATTAAATAAATACAGTAAGGT
CAGTATGTTTATGTCCCTCTTATTCCCACAAAATGCATGTGTAGACGTGGATGTATGTCGCAATTCCTGTGGTGATCTACATTGGAGAACGGATGTTCAGGATGGTCAGATCTATGGTGT
TCGATGTCAAGATCCTCAAT
GTGTGATAATCTGTAACAAATAATGTATTCTTTTCGGTGAAAATATGAGTTGTTGTGTCAGCTTTCAATCATTACTTTGTTTTTTTTTTCGTTTTCTGCT
CCTTTTACAGGCCACAGTTTATCCAGGGATGGTACTTGCACTCAAGGTGACAAAGCCTCCAGGTTTTCGGTATCAAAGTGGAATGTATGTATTTGTCCAATGTCCAGAAGTATCAAAGTT
TGAATG
GTGAGAATACCTCTACAAATTATGCTAGTCAACAACTGCTGTGCTGTACAAATTTCAATTGTTAATTTCCTTCTGTCACTTGAATGAACTGCGTCCTTGGACATTCTTACCTAT
ACTAATTCCAGATTTACTTTATCCAACTGTCTCAGGCACCCATTTTCCCTTACATCTGCTCCAGACGATGATCACTTGAGCATCCATATAAGATCTCTTGGTGATTGGAGCTACCAAATG
TATGATGTCTTCCAACAG
GTGAAGCACCAATTCTTTACCACTCTTCAAACAAGAGATTTTTTTTTTCTTCTCAAACGCTCTTCAAACAACAATTATTGATACTTAAAAATATGTTTTGAG
TTTTGTAGATGCTACTTTCCAGCAACTCCAGCATGCCTAAAATATTCTTTGATGGTCCCTACGGTGCAGCGTCACAGGATCACTCAAAGTACGAAATTATATTGTTAATTGGACTTGGAA
TAGGAGCAACGCCTTTCATAAGTGTTCTCAAAGACATTGCCAATGGATTAGATAAG
GCAATGACTGCACCTTCATGATATGCAATTTACGTCTATCATATCAGCTGAAAATCTATCATAT
TTATCTGAAACTATCTCAGGGGCATGGCAACTTAAATTATCACTCTGACCGACTGAAGAAGGCCTACTTTTATTGGGTGACAAGAGAGCAAGGATCCTTTGAGTGGTTCAGGGATATCAT
GAAAGAGGTTTCGGTTCTAGACAGCAAGCAG
GTTTCACTTTTATAACCACTTTTAATTAAAAAGTAACCATACTTATCTTCTTCACAGATGGCATATGGCCACGTCACTACATATGATGC
ATTGTTAAGATGTTATAATGCACTTGTAGGGTGTGATAGAAATGTATAACTACCTGACAAGTGTCTACCAAGAAGGTGATAAGCGGTCGATGCTAATAAGTGCGATTCAAGCACTTCATT
TTGCACGCCATGGCATTGATATCATCTCAAAAACTCCT
GTAAGCATATCTATTTCCAACGCAACTACGCATGACACAAGTGTTGTGCGCCTAATATCTTTGGTTCTCAACCACATGTCGC
TACACACTAGTAGGGGTGGTAATGGGCTCTAAATTTTACGCTATAGAATTTCAGGATCGAATCATATTAGGATTAGGCTATATTCCTATTCATTTTTGAACTAAAATTTATTAAGAGACC
TAACTTTTTATGAAGAAACATTTGGATCACGATCCATTACCACCCCTACGCACTAGCTTTGGACAATGTGGAATGTTAAACACAAATCTATAATTTGTAGGTTCATACGCACTTTTCGAG
GCCAAACTGGCCTAGAGTGCTACATGGCCTTGCAAGAAGGCATATCGGGGAGAGGATAG
GTAAGAATACTGTCTTGTTCATGCCTAGAAACTTAGTATTCCCTTTCCTGAAAATTAAATG
AAAGAACAACTTAGAGATGAAAAAGGCAAAGGGCATTCTTTATCTATTTCATGATTTGTTTAGTCATAATGTTTCATGCATAACAGTGATATTAGGGGTCAAATAAAACTTAAACTTGCC
CAGAGTAAAAACATGATATTAGGGATCAACTAGAACTTGCCCCAGAGTAAAACTAACGCACAGAACTACTTGACTGGTGCATCAAAACGCCTAAGAGCATGTCAATTCGGGTCATTATAT
AAAAACATGTTTAGTTTACCATGGTTATTTGGTGTGTACTTCATATTTTACGTGTGCTTGGCATGGCAATATTCTCATTCGTCTTCATGTCCTAAGGAGCTGCAGAAATTTTCTTCTGTA
TTAGGATAACCTAGTAGAAGAAACTCTTAGTGTGGAGAAATATTTGCTTCTCTGTTCCTCCTAAATTGAACTTGAATGCATTTGGCAGGGGTTTTCTACTGTGGTCCGGACGATTTGGGA
AGGCAGCTGGAGAAGCTCTGCCACAAAGTGAACACAAAAACATTCACGCGATTTGTGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CGGTGGGTGCGCCTAGAGCCTGCAGCCACCGTAGCGAAATCTCCAATCTTGATGTTGCGCGGGGCGAAGATTGCCTCTGCCGTCGTTAGGTATGCCGATCAACCAGAATTGTTTACGCAA
GCATATCTTTGCAGCTGCGACAGAAACTCAACTAGCAGAATCACAGGGAAGGATATTAAGCAG
GCGATTATGTTCAGTGCCTCTTTGAACAAGCTCACATTAAACCAAGATGAGGCCACC
GAATACACAAATTTGATCCTAGAAGAACTTCAGACAGGTCAAGGAGTCCTCCAG
ATGAATGTCATGAGCAAGGGCCTGTCAAGGGATCTCCAACCAACCTGCGGGCCAATACCAGTGCCA
ATGAAATGCAGCCGACAGCGACATATACTTACTGCAACCGTAGTCTTCTTCCAAGCTCACTGGAGGCGTATATTTGTGGTTTTCTTGTGGCTCATGGCATGTGCTGCACTCTTCACATGG
AAGTTCATGCAGTACAGACAGCGGTTGGCTTTCGAGGTAATGGGGTACTGCCTGTCGACAGCCAAGGGGGCTGCAGAGACGCTCAAGCTCAACATGGCCATTGTGCTCCTACCTGTTTGC
CGCAACACGGTCACTTGGCTCAGGAGAAGCCGTGTTATCAACTCGGTCATCCCATTTAATGACAATATTAACTTCCACAAG
CTTGTTGCAGCGGGAATTGTGATCGGTGTAATCCTTCAT
GGAGGCATCCACCTGGCATGCGACTTCCCAAGGATCACAAGGACAGATAAGGCCTTCTTTGGACGCACAATTGCCGCTGACTTTGGGTACCACCAGCCATCCTACCTGGAGATAGTGGTA
TCAACCGAGGGGACAACTGGTATAGCAATGGTGGTACTAATGTTTGTCGCATTCTTGCTTGCTAGTAGTCCTTCGAGAAGAAATCCAGGAATGCTGCCACCTCTCGTCAGACAGTTAGCT
GGGTTCAATGCCTTCTGGTACTCGCACCATGTGTTCATCGCTGTCTATGTGCTCCTCATTGTGCATTCCATGTTCCTATTCCTAGCAAAGGATGTAGCAGAGAAGACG
ACGTGGATGTAT
GTCGCAATTCCTGTGGTGATCTACATTGGAGAACGGATGTTCAGGATGGTCAGATCTATGGTGTTCGATGTCAAGATCCTCAAT
GCCACAGTTTATCCAGGGATGGTACTTGCACTCAAG
GTGACAAAGCCTCCAGGTTTTCGGTATCAAAGTGGAATGTATGTATTTGTCCAATGTCCAGAAGTATCAAAGTTTGAATG
GCACCCATTTTCCCTTACATCTGCTCCAGACGATGATCAC
TTGAGCATCCATATAAGATCTCTTGGTGATTGGAGCTACCAAATGTATGATGTCTTCCAACAG
ATGCTACTTTCCAGCAACTCCAGCATGCCTAAAATATTCTTTGATGGTCCCTACGGT
GCAGCGTCACAGGATCACTCAAAGTACGAAATTATATTGTTAATTGGACTTGGAATAGGAGCAACGCCTTTCATAAGTGTTCTCAAAGACATTGCCAATGGATTAGATAAG
GGGCATGGC
AACTTAAATTATCACTCTGACCGACTGAAGAAGGCCTACTTTTATTGGGTGACAAGAGAGCAAGGATCCTTTGAGTGGTTCAGGGATATCATGAAAGAGGTTTCGGTTCTAGACAGCAAG
CAG
GGTGTGATAGAAATGTATAACTACCTGACAAGTGTCTACCAAGAAGGTGATAAGCGGTCGATGCTAATAAGTGCGATTCAAGCACTTCATTTTGCACGCCATGGCATTGATATCATC
TCAAAAACTCCT
GTTCATACGCACTTTTCGAGGCCAAACTGGCCTAGAGTGCTACATGGCCTTGCAAGAAGGCATATCGGGGAGAGGATAGGGGTTTTCTACTGTGGTCCGGACGATTTG
GGAAGGCAGCTGGAGAAGCTCTGCCACAAAGTGAACACAAAAACATTCACGCGATTTGTGTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA