Entry information : ZmAPx06 (GRMZM2G014397[6a])
Entry ID 6709
Creation 2009-04-15 (Christophe Dunand)
Last sequence changes 2009-04-15 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmAPx06 (GRMZM2G014397[6a])
Name (synonym) ZmAPx06 (GRMZM2G014397[6a])
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx06
start..stop
S start..stop
SbAPx06 585 0 1..313 1..313
SiAPx06 584 0 1..313 1..311
TaAPx03 572 0 1..313 1..313
HvAPx05 568 0 1..313 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10725674..10725757 84 N° 2 10725856..10725972 117 N° 3 10726375..10726495 121 N° 4 10726567..10726667 101
N° 5 10726774..10726861 88 N° 6 10729368..10729435 68 N° 7 10729515..10729601 87 N° 8 10730090..10730164 75
N° 9 10730242..10730319 78 N° 10 10730408..10730512 105 N° 11 10730605..10730622 18  
join(10725674..10725757,10725856..10725972,10726375..10726495,10726567..10726667 ,10726774..10726861,10729368..10729435,10729515..10729601,10730090..10730164,107 30242..10730319,10730408..10730512,10730605..10730622)


exon

Literature and cross-references ZmAPx06 (GRMZM2G014397[6a])
Protein ref. UniProtKB:   B4FG49 [5' end]
DNA ref. GenBank:   AC196114.2 (65588..70536)
mRNA ref. GenBank:   BT036087 [5' end]
Cluster/Prediction ref. UniGene:   Zm.13185
Protein sequence: ZmAPx06 (GRMZM2G014397[6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313
PWM (Da):   %s   33983.54  
PI (pH):   %s   8.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIHYLLRRGVSGGSLLHPIRGLFLASKELGRRPLGSAAAGDAAAELRGAREDVRQLLKATSCHPILVRLGWHDAGTYDKNITEWPKCGGANGSLRFEVELKHGANAGLVNALKLIQPIKDKFSGVTYADLFQLASATAIEAGGPKIPMIYGRVDVIAPEQCPPEGRLPAAGPPSPAEHLREVFYRMGLNDEIVALSGAHTLGRARPERSGWGKSETKYTKDGPGAPGGQSWTSHWLKFDNSYFKAIEERRDDHLLVLPTDAVLFEDSSFKIYATKYAKDQDTFFEDYAEAHAKLSNLGAKFDPPKGISLE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, 10 introns), 5 mRNA and 139 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCCACTACCTCCTCCGCCGCGGGGTCTCCGGTGGCTCACTGCTCCACCCTATCCGCGGTCTCTTCCTCGCCTCCAAGGTACCTGCGGCTTCTCCCCTCGTCCTCACCCACTGC
CCTCGCCGTCACACCGGTCCTTGATTTCGTGCGTCCTGTCTGCTTCTTTCCTGGCGGCGCAGGAGCTTGGGAGGCGTCCGTTGGGCTCTGCGGCGGCGGGAGACGCAGCGGCCGAGCTGA
GGGGCGCGCGGGAGGACGTCAGGCAGCTGCTCAAGGCCACCTCCTGCCATCCCATCCTG
GTAGGTAGTTCTTTCTCCTCATGCTGAGGCTCCCTGCGGTTGGAGCAGACAAGTGACTCTA
CTGTGGGGTCTCGTTTATTCATCATTTCATCTAACGACCCAGAGTTTATGCATCTCTACAAAGTTTCTCTCATGTCTCGTGCAACTGAAGAACTAATACTCCGCAGCCTTTTGTAATGGT
AACTTAGGAACTTGTACAATTTAGTTGGTCGTTTGTTTACTCAGCTGACCACGACAGAATTAGGTTTGGGAGATGTGTTAGTGCCCCGGATGCACTGTTTCTCTTTGTTTATGCTAGATC
AAGTTTGGTTTTTTTTTGCTTTACTGCTTTCCTCTTCACGATCCAGCATTAGCTGGTTCAGCCTCGGGGTTGCTTTGCTTAGGTATTATATTTTCGTTCAGGTTCGATTAGGTTGGCATG
ATGCTGGTACATATGACAAGAACATTACCGAGTGGCCCAAGTGTGGTGGAGCTAATGGTAGCTTGAGATTCGAAGTCGAGTTGAAGCATGGGGCCAATGCTG
GTAACACTCATCTCATCT
TATCATCTGTAACTTCATGAAGTGGTGCTGCTCAACATTTTGTTTCATGACAGGTCTTGTGAATGCTCTGAAGCTGATCCAACCTATCAAGGACAAGTTTTCAGGTGTTACCTATGCAGA
TCTGTTTCAGCTTGCCAGCGCCACAGCCATTGAG
GTCCCTTAAAATCGCTCCAGCTTGCTGATTAAGTGATGGTCATTCATAAATTGCTTGTTTTTAATGATGACTGCCTGACTGGTTCT
TGTGGTTTCTTTCATTTCAGGAAGCAGGTGGCCCCAAAATTCCTATGATCTATGGAAGAGTTGATGTTATTGCCCCCGAACAATGCCCACCAGAGGGGAGGCTTCCTGGTCAGTAATTAT
GATTTTTTGATTGATCTGAACTCATATGCCAATTTTGGTTGAGTCAGACACAGACTCAGAATCCAGAACCTAGAACATAGGGTTGTTCCTTTAGTTTGCTTTGATGTTAATCCAAGCATA
CTGTTGCAATCATTGCTTAGTGATTGAAACATCGAATAGCTATCTTATTCATTAACCTTGTATGGTTGTGCTCAGGGTTCTACCACATAGCAAACTTGCAGCTAACTCCCTGATTAAAAA
TTGATAAACTCTCTCTTATCAAATCATTATCATATAGATGAATTGTATTTACTAGCTTAGTTGTTCATGAAAGTTTAGCATGTCAGTACACTGACAGTCTTCAACAGATTAGTAATACCA
AAGTTCATGATTCTTGTCACATAAAAAATACTTTGTCCTGGTCCTGGACATCATCCAGATATCCACTTTATACTAAGACTGATCCTATCAGATTTATGGTACCTAATGTTTATTTGTCTG
CAAGATGCAAATTTGGCACACAAAAAATTAAAATACAAACAAAACACGGATGCAATATTGCAAGTAGAGGATGTAAATACAGCATATACTTCCTGGATAACTTTTAATGGTACCTCTTTC
CATTTCACTAGTTTTTGTTAGGGTATTTGTAGTGCCTCCAAATTCAGCTATTAAGATGGTTTCATGGTTAAAACAACGACAATAAAGCCTTTTAGTCCCAAGTAAGTTGGCTAGGTTAGA
CCGCTAGAGTTGAATTCAATAGAAACCACAAGTCAAGGTTCAGGCTTATGAATTATTGTTTTCTATGTACCCCAATTCAAGCCTAAATCTTTGGGTATATTACATTCTTTCAAGTCCCCT
TTTGATGTTAACTTTGGTTTTTCTCTGCCTCTCTTTTCATTGCTATCATGCCTTAGGATCCCACTACGCACTGATGGCCCTAAAGGTCTCTGTTGGACATTTTCAAACCATCTTAACCAG
TGTTGGACAAGCTTTTCTTCGATTGGTGCTACCCTAGCCTATTATGCATATCATCGTCCCAGACTTGATCTCTTCTTGTATGACCACAAATCCAACGCAATAACAAACTCGATCAACCGG
CCAAAAAAATCCAAGACTTACTCTCCCTCCTGATTTCTACTACCATATCCCAAACCTTCATGAACCGCCTCAAAACCTGCACTTGTTACACCTACATGTCCATTGAGATTTCCTCCTATG
AAAAGCTTCTTACTAATAGGTGTAGCTCTAACCATGGCATTTAAGTCTTCCTAGAAAAGTCTCTTGGCACTCTCACCGTGGCCTCTTTGGAGGCATACACGCTAATTATGTTCAAAACCA
AATCACTCATGACAAGTTTGACTAAGATAATCCTAGCTTCTTGCCTTCTCATATCTACCACATCGTTCTTGAGGCTCTTATCAATCAAAACTCCCTGCTTCATTTCTATTCGTAGCTGTC
TCTATGTACCAAAGCTTGATCTGATATTGTTAACTTCTTTCCTCTTTTGACCCTAGTCTCTTGGACGTATATGATATTTACATGCCTCCTAGTCGTTACCTGAACTAAGTCCCTTAACTT
ACCTATAAGGGACACTAGATTCCAACTACCTAAACAAATTCTAGTTGGTTCGACTAGCTTTCTTACTCTTTACACCCGTTGATGATATGAAATGAAGACCCTTGCACATTTTCACTACAC
CTAGACGCTGATGTAGCATGCCACTAAGAAAGTAGTGATCCAATCCTTTATCACTTGATACTGTGTCCAGATCGCGACACGACACATCACCAAGGGGCTGTAGACCCGGGTCTTGCCCAT
TTAACACCATTACCATGGTTTCGATATGGCACATCGCTAAGAGGGTTACGCCCCAACAAATTTCTTTTGAGTTTCATCTCCATTAGAATGACTAGGTTTAACGTTGGCTCACCAAGCCTA
TCGTAGTCCTCCTCCTTTATTAATCTTAGGATTTGTTATGTTGAGACAACATAGGTGGAGTTGGTTTCATGGTTAGAGCAAATTAATCTATATTCTTTTGGAATTTAATTAGTAAGATGT
GAAGGATAGAAACGAGCTGATGTCATAGAACAATGTTAAGTGATCTATAAAGCATAAGTCTTTTTAAAGAATTACCTTTGTGGGATCTACAGTTGTCAAATCAAATGACTAACATGCAGA
GTGCACAAGATAAACTGTTTCAAGTTCCTGCATCCTAAAATGCAACAAAGTGTTGAGAAGCAGTACTACCTAGAATAGAATCATGTTCATACAGTTTTGTTTTGATCATAGAATTAAAAA
GTCACTGCACATTATCTTCCTAAGCATTGCAATGATTTCAAGCACCCCTTCCCAGTGGTTTCTGATTGATCTCTTCCTATGCCATGTAATTATATTAAGTTTGACAGTTCAATATTCTCT
ACTGCTTGCTTCTTTGATGTGCCAGTGCATTATTTATATACAGAAGATTTTATTCCAGGGTTACTCATATTTCTATTTTTTTTCGCCCATTCAGCTGCTGGCCCACCTTCACCCGCGGAA
CATTTGCGTGAAGTATTCTACAGAATGGGCCTGAACGACAAG
GTGTAAACAGAATGCTGTGTTTAAATTAGACTATGCATAATTCTGAATTTGCTAGTCACAACTATTTTGTGCTCTGTA
GGAAATCGTTGCACTGTCAGGAGCTCATACACTTGGACGTGCAAGACCAGAGCGTAGTGGCTGGGGTAAATCAGAAACAAAGTACACTGTGCGTAACCTACAGCTTTAATCAAATGTTGT
CCTTTTTTTCAATTCTTGCATTTGCATGTCCACCCTTCATAATCTACTTATTATATTAGGCAGTAAAATGTGAGTGTAACCTATATTTTCTGGCCGTGCTTGACTGCTACTCGTTTGTTT
GTCCTACTGATTCGTCCTTGCTTATATGCTTGCTGCATGGACACCATATTTGATTACTTGTCGTGCTGATATCTGATAAAACATTCTTCTGTACTGTGCCCTGCGAAATTGCTTTTCAGT
TTTCACTATATTGTGGTGTGTCTGCTAGCTTTTCCCTCTATGAATCTTAGTTCTATTTTCCCCACTATTATTCTTGTAAAGATGCTCTTTGTGCGATTGGTACAGTATTAGCACCTAGAC
ATTCAGTGCTGTTTGCTAAATGGTGCTGAGAGTGGTCAGTGGTGTTATCACAGTATCACACTCATTTGTTAATTGTTCTTTTGTTTGATATGCCAGAAAGATGGGCCTGGTGCACCTGGG
GGACAATCTTGGACATCTCATTGGCTCAAGTTTGACAACAGCTATTTCAAG
GTATTGTCGCTATAGGATTACCTTCGAAGGCTTCAGCCATGTAGGTTTATAACAAAAACATGATCATAA
CAATTCAGGCTATCGAAGAAAGACGAGATGATCACCTCCTAGTTCTGCCTACTGATGCTGTGCTGTTTGAGGATTCCTCATTCAAGGTTAGTGAAGGGTTCTCATGTTGCAAAAAACTGA
ACATGTCTGTTTTTTCTCTGGACCAAGTCTCATGATGACTTTTCATACTTGGAGATCTATGCTACAAAATATGCCAAGGATCAGGACACATTTTTCGAGGACTACGCTGAAGCTCATGCC
AAATTGAGCAATCTTGGGGCAAAGTTTGACCCGCCAAAG
GTAAATGGAATCAGGGCACTTTCCATTCTGAGAGGTAGAAAATAACTATGTTCTCAGGTCGTGTAACGTGCTTTTAATTGA
AATGTCTGCAGGGTATCTCACTCGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCCACTACCTCCTCCGCCGCGGGGTCTCCGGTGGCTCACTGCTCCACCCTATCCGCGGTCTCTTCCTCGCCTCCAAGGAGCTTGGGAGGCGTCCGTTGGGCTCTGCGGCGGCG
GGAGACGCAGCGGCCGAGCTGAGGGGCGCGCGGGAGGACGTCAGGCAGCTGCTCAAGGCCACCTCCTGCCATCCCATCCTG
GTTCGATTAGGTTGGCATGATGCTGGTACATATGACAAG
AACATTACCGAGTGGCCCAAGTGTGGTGGAGCTAATGGTAGCTTGAGATTCGAAGTCGAGTTGAAGCATGGGGCCAATGCTG
GTCTTGTGAATGCTCTGAAGCTGATCCAACCTATCAAG
GACAAGTTTTCAGGTGTTACCTATGCAGATCTGTTTCAGCTTGCCAGCGCCACAGCCATTGAG
GAAGCAGGTGGCCCCAAAATTCCTATGATCTATGGAAGAGTTGATGTTATTGCCCCC
GAACAATGCCCACCAGAGGGGAGGCTTCCTG
CTGCTGGCCCACCTTCACCCGCGGAACATTTGCGTGAAGTATTCTACAGAATGGGCCTGAACGACAAGGAAATCGTTGCACTGTCAGGA
GCTCATACACTTGGACGTGCAAGACCAGAGCGTAGTGGCTGGGGTAAATCAGAAACAAAGTACACT
AAAGATGGGCCTGGTGCACCTGGGGGACAATCTTGGACATCTCATTGGCTCAAG
TTTGACAACAGCTATTTCAAG
GCTATCGAAGAAAGACGAGATGATCACCTCCTAGTTCTGCCTACTGATGCTGTGCTGTTTGAGGATTCCTCATTCAAGATCTATGCTACAAAATATGCC
AAGGATCAGGACACATTTTTCGAGGACTACGCTGAAGCTCATGCCAAATTGAGCAATCTTGGGGCAAAGTTTGACCCGCCAAAG
GGTATCTCACTCGAGTAG

Retrieve as FASTA