Entry information : ZmAPx07 ( GRMZM2G120517 [6a])
Entry ID 6710
Creation 2009-04-15 (Christophe Dunand)
Last sequence changes 2015-07-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-07-07 (Christophe Dunand)
Peroxidase information: ZmAPx07 ( GRMZM2G120517 [6a])
Name (synonym) ZmAPx07 ( GRMZM2G120517 [6a])
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx07
start..stop
S start..stop
SbAPx07 573 0 32..339 34..344
SiAPx05 556 0 1..339 1..342
BdiAPx07 552 0 19..339 20..345
TaAPx02 544 0 42..339 47..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49733021..49733179 159 N° 2 49732784..49732900 117 N° 3 49729760..49729880 121 N° 4 49729561..49729661 101
N° 5 49729387..49729474 88 N° 6 49729033..49729100 68 N° 7 49728863..49728949 87 N° 8 49727717..49727791 75
N° 9 49721864..49721941 78 N° 10 49721667..49721771 105 N° 11 49721470..49721490 21  
complement(join(49721470..49721490,49721667..49721771,49721864..49721941,4972771 7..49727791,49728863..49728949,49729033..49729100,49729387..49729474,49729561..4 9729661,49729760..49729880,49732784..49732900,49733021..49733179))


exon

Literature and cross-references ZmAPx07 ( GRMZM2G120517 [6a])
Protein ref. UniProtKB:   B4FHN3
mRNA ref. GenBank:   AY105926.1
Cluster/Prediction ref. UniGene:   Zm.81248
Protein sequence: ZmAPx07 ( GRMZM2G120517 [6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339
PWM (Da):   %s   36905.96  
PI (pH):   %s   9.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERLAASAATLRASAAATPFARRAAPANRAFFSPSLARARVGLRAAPSSLPQKARAVRCAAVAMASDAAQVKAAREDIRELLRTTHSHPILVRLGWHDAGTYDKNIEEWPQRGGANGSLRFDVELKHGANAGLINALKLIQPIKDKYPSITYADLFQLASATAIEAGGPKIPMKYGRVDVTGPEQCPPEGKLPDAGPSSPADHLREVFYRMGLNDEIVALSGAHTLGRSRPERSGWGKPETKYTKNGPGAPGGQSWTVEWLRFDNSYFKDIKEKRDQDLLVLPTDAALFEDPKFKVYAEKYAEDQDAFFRDYAEAHAKLSELGAKFQPPQGFSLDD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo ?, 10 introns) and 107 ESTs. Also found in AC194336.3.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGCCTCGCAGCATCCGCCGCCACCCTCCGCGCCTCGGCCGCCGCCACCCCATTCGCCCGCCGCGCGGCGCCGGCCAACCGCGCCTTCTTCTCGCCTTCGCTAGCTCGCGCG
CGCGTCGGCCTCCGCGCCGCGCCCTCTTCGCTCCCACAG
GTCCGTATACCGCGTTCGTTGGATACCAGTGCGCCTGCGGCTTCATCCCTAGATCGAAAATGGTGCAGCAGCAGCAGCATC
AGACAGGCTGTTGACTCGAGTTTACGTGTGTGATCGCAGAAGGCGAGGGCAGTGAGGTGCGCGGCTGTGGCGATGGCGTCTGACGCGGCTCAGGTGAAGGCCGCACGCGAGGACATCAGG
GAGCTTCTCAGGACGACTCACTCCCACCCCATCCTG
GTGCGTATGGTGATCCCTGTGTGTTATCCATAAACTTCATCAATTATGAATTCATGATGGTGATGCATTGTTCAAGATGTTTTG
ACTAAACCCTTTGCAGTCATACCATCACACTGCTACAATAGAAGATGTGAGGCTTTAAATTGCGATCTTACTATGGTGGCATCACTGCCAGCGAACATAGTGATAGTGATCACTTAATAA
CTTTGTTAGTGATGTCCATTTATATACGCCTCTGCAGCACATGGTGTGTGAGCAGAGAACTGAGCAGGGTGCCCGTTTTGTAATCAAGTATTCACTGTTGATCAGTGGCAATGGCTGACC
CAGAATTTAAACCTAGGGCAGTCGAGAACAAAAAAATAATCTTGACATGTAATATTGTGTATACTTCGGTACTATGTATATATAATTTCTATCAATTCGTTACATAAGCAGAAAATGAGC
AAAATATCTGATAATGAATTTAATTCATCAAATTAGGTTCCAAGTTGCATATATTGTTTCTTTGCGCCTAAATACTGACGAGTAGTTTGTTTTTGGACCAAATTACCGGGTAGTCGGGGG
GGGGGGGGGTACCCCTTGGGTCCGCCCCTAACCAGTGGCAGATCCAGATTTTTTTTACTATAGCCACTTCTACTAGAATATGGGTTATTGCTGACTTATAAATGTTTTCCCTAATTATGC
TTAGGCCCTGTTTGGATCCTTGGAATTGAAATCCATTCTAATAAGCATAATTTAGGCGCAAATCAATTAAGTAAAAAGGGTTGTAGGCCCAAAATATCTAAAATTTATATACAATGGGCC
CCCTTACAAGGGAAAAATTTGTATGTCCCATTTCTGCGGAAGGGGAAAAAGCTAAAAAACTTGGAATAAATTTGTAAAGCAAAAATATGGAATGAGGAATTTCTTTTTAAATTTGTATCT
AAAATTGGGGAAGAGGGGGAATATCAAGTTTTAAGCCAAAAAGCCATAGTCTACTTGGGGCCTGTTTGGTTCCTTAGCTGAGCGTATTTGTCCCTTGTTTAGCCAAGATGACGAGAAAGG
CCGGGGGTTTGGTCCCCTCCCCTGAGCGAATGGGGAACTGTGCAAGAAAGCTTTACTTTGCTCCCGGGGGATAGCAAAATTGCACCTTTGGGGGGGCGAGTTTCTCGTTACTCATGCCCC
CCAAAAAAAGGAGGGGGGGTGGATTGCCCCAGGAACCAGGGGGCATTAAGACTGTGTCCGGCAGTCCCCCATATGGCCCCAAAAACCCAGTTTTGCACTGAAGATTATCCGGTCGCAGAG
GGGAGTTTGAAAATAGGTATGGGGAGGGAAAGCGCCGGGGAAAGCTTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTGCAGGCAATAAGTCTCCTAGTGTTGTTGTTTGGAATGATAACCTATAAGCGTTCCACAAGTTCTTAATTTTTCCTTAGGAGAACG
TCAGAGAGACTTTTCATGAGCGAAGTAGGCGGCATCCGTAGGAGAATCCAGAGCCGCGGGGGACCCTCTGGCCAGGGGTTCCCCGAGGGTGGCAGATTGGTTTGCCCGGCGAGGTTGCTC
GACAATTGGAGGAGCGGTGCGGGTAGCCCAAAGGCGTGGCCCGGGGGGTGCCGACACAGCAAAAGGGAATTTCCGGGCCCGGGACACCAGGAATGGGGGCCCCCAGGGGTTCGGCCAGGG
CCCAGGGCCCCCTTAGGGAAAGCGGCCCGCGGCCCCCCAATTCCGGGGGAAAGGGCCCCCCCGGGCCCTTTGATTCCCCGGGCCGGGGGGGGGGGGGCGAGGCCTGGCGGCGCGCCGGCC
GCGGGGGAGAGGGCCGCCGCGGGGGCGGCGAGTCCTGGCGGCACGCTGGCCGCAGGGGAGAGGAGCGCCGCGGGGGAGATGCCCGCTAGGGGCGCGGCGAGGGCCGCCCTGTAGGAGAGA
GGAAGGGGAAGGGGAGGGAAAGGGTCGCTGGAGAAGGGAGGGGGCGGCGGGCGACCGACCATGGAGAGGCGGCGGCGGCTGGAGGGGTGGGGTGGGGGCGGCGGCGGCTGGAGGGAGGAC
CTAGAGCTCTGGTACCATGTTGGATTGAATGAACAGTCAACAATACAGTGCAAACCCTAACCCTAACAGATATGGACCCCTAATGGGCTGTGGGCTAGGCCCATGTACACAGATAGCTAA
CAGTTCGATTGCTCATAAGATTGTATTAACTAATTCAAAGGGTAGTGTCCAGTTCAAACTTAATGATGTAGTAATGACTAAGGTCACTATGTTGATGAAAGGCATTATCCAATGCACGCT
TCAGGATTGTCAGAGTACTCATTAGTTATGCTGCATTTTTAATCATTTTACATTTGCATGATCATATGACTTTTATGTCTTAAGTTTTAGAGGTTAAAAATACAACAGGACCCCATTTGT
TGAGATAGGCTCTGTTGAATGAATTTCTGAGTATTTGGATTTCCTGCTATCAAATTCAACACAATTTTTGGTGGTCTATTGTCTAGTACTACCTCCATTCACAAATATATGACACCGTTG
ATTTTTTTTAAAAACTTTGACCACTCGTCTTATTCAAAGTATTTATTCAAAAATGTAAAATTTTAAGTCAAGCACAAAATACCTTAAGTGATAAAACAAATCACAAAAAAATAAATGATA
ACTCATTATTTTTTTGAATATGACGAGTGGTCAAAGTTGTTTTAAAAAAGTCAACGGTGTCATATATTTATGAATGGAGGGAGTATTTTCTGTGACATATATGTATGGAGTCAGGTTACC
TTTGGGCTTCATTTTCTGTATGCAAGATGACTTATTGTTACATGTTTGATTGGATGAAGGTCCGTCTAGGATGGCATGATGCTGGTACGTATGACAAGAATATTGAGGAGTGGCCACAAC
GAGGTGGAGCTAATGGAAGTTTAAGATTTGATGTTGAGTTGAAACATGGAGCCAATGCTG
GTACTGTTACTTGACTTCTCTCAGTATCATACTATCATTGTTTTATTCTTCTAAAGTGTA
CAATTAGTAACTGCAACCTCTGATTGGAATTTTAAAAGGTCTGATAAATGCTCTAAAGCTTATCCAACCAATCAAGGACAAGTACCCTAGTATCACTTATGCAGATTTATTTCAGTTGGC
AAGTGCTACAGCAATTGAG
GTCTGTCCTTTCCCTCATTGAAGTATGTAGCTATGCTATTTTTAATCGTATGCTACTATGTTAAATACTAGTCAATTTCACTATAGGAAGCTGGTGGCCCA
AAGATTCCAATGAAATACGGACGAGTTGATGTTACAGGACCTGAGCAGTGCCCCCCTGAGGGGAAACTTCCTG
GTTAGTAGATCTCCATGGCTTTGCAGTGCTCTTTTTCCAGTACCAAT
GCCCTTTATTAGTTTGCAGGAAGAGTTCAGATATCAAAGATATACTTAGAGATTTCTCTGCTAGGAATATCAACTAACCGTATTTCACATTTCCAGAGTAGTCATGGAAATACCTCCACT
GCCACATTGATGTCGAAAAACTGTTGTTATGTAGAGGGGAATAGATGCACCAGCGTATAAGCCACCACTAATCTGATGCCCGCAAACTTTTAAGTTTTTCTTTATCTTGTGTTCCACAGA
TGCTGGCCCAAGTTCACCTGCTGACCACTTGAGGGAGGTATTCTACAGAATGGGCCTTAATGACAAG
GTGTGCAGATCACGACACTTAACCAGTATGTGTGTCTAATTGACTTTGTTGAG
CTGTTTGAAATTCTAATCATGAGCTTGCAGGAAATTGTTGCCTTGTCTGGAGCACATACACTTGGAAGGTCCAGGCCTGAACGGAGTGGCTGGGGGAAACCAGAAACAAAATATACTGTA
TGTTCTTATCTTCTTTATGTGAGGTGTAAAGCAGGAACACCAGCTAGGAAGTCTGTTTTGAGCATGAATTGTTCCATACGGTGTCTTTATCAAGGATTGCATTCAACAACAACAACAAAA
ACTTTTAGTCCCAAGCAAGTTGGGATAGGTTAGAGTTGAAATCCAACAAAGACCACAAGTCAAGGTTTAGGCACATGGACAGCTGTTTTTCATACACTTATATTTAAGGCTAAATTTTTG
AGTAAATTCTATCCTTTCTAGTATTTCAAGTCTCATTTTACTGTCTCTTTCCATATCAACTTTGGCCTTCTACTGTCTCTTTTACCATTGCTATCGTGCCTTAGGATTTGACCATGCACT
AGTGTCTTTGGAGTTGTACATTGATCATGTTCAAACCATCTCAACCGGTATTTGACAAGCTTTTCTTCAATTGGTGCTACCTCTAGTCTATCATGTATATCATTGTTCTGGACTCGATCT
TTCTTGTATGACCACAATTCCAACACAACATACACATTTTCGTAACACTTTTATCTTTTTGTAGGCCAATATTCTGCATCATACAATATAGCGGGTCTAATCACTGTCCTATAAAACTTG
TATTTTATCTTCTGTGGTCCTCTCTTGTCACATAGAACGTCAGATGTTTGGCGCCAATTCATCCATTCTGCTTTGATTTTATGGCTAACATTTTCGGCATCATCGCTCTCTTTGTAGCAT
TGATCCTAAATATTGAATGGTATCCTTCCGGGTTACTACTTGACCTTCCAAACTACATGACCAAGGATTGCGTTGCATTTATAATTTTGCAATAAGAGGAACATTGCAATTTCTTAATGC
TTTGGTACATTGCACCTGCACAACTCCAAGAATTGTCTTTAACCTTTCTGGGATGATTTTGTGCAATATTTATGTACCGCCTAAGCTCTGTGCAACATGTATTGTCTCTTTGTCTTCTTA
CTTCGCTTGCTTGATTAAGTCAAATTTGTTGCATTGTGTATGTGAATAAATTGAGCTTGTCTTGTTTATCTTATGAGCTCATCTACTATGTCTTGTTACTCTTTACAGAAAAATGGTCCT
GGTGCACCTGGTGGGCAATCATGGACAGTTGAATGGCTGAGGTTTGATAACAGTTACTTCAAG
GTGTGTGCCTTGTTATGTATGGCCAAGCCTATGTTAGGCGCAATAGGGCCAAGGCTG
CCCAGGTGGGGCCCAAGGCCCAATAGCTAATAGATAAGCTCTATCTAGTTAGTTATACTTATCCAAAGATAGTAGATAAAGATCAGCTCTATCTAGATAGTTATACTTATCCAAAGTTAG
TAGATAAACTTGAGATAGCTCTATATATAGATCTGTAAACTCTGGAATAAAGACAAGCAGAATTCCAATCTATTTTGGCTTCCCAGAGGGAGCCAGAGTCTCCTGTGATCTTCTCCCTGC
GCACAACCCAGCCAGGATCACGACGGCGCCCCAGCGCCGCCACCCTGGTCCCACCAAATCCCCTCCCTACAATCTGCGCAATCTGCCCGGTAGAATTCGTAGTTCTACCAATCTGGTATC
AGAGCACTCGACGATCATGAGTTCCTCCAAGTCGCCGTCACCGGGACAGCAGCCGCCGCCGGCCTCAAGCCCGCCCGCAGCGCCGGTCGTCTCCCTGGCCGTGGTCCCTGCGTCGTCGGA
GGCCATGGCGCTCGGCCCTCCCGGCGCGGCCATCAACCAGCAGGCCGCCCCCGCGCTCACACCGGCCTAGATCGCGGCGTCCTTGGCGGATCTCAGCCACGCCGTGCGCGATATGCAGAT
CACCATGAACGCCATGCTGACAGGCCACCTCCCCTTCCCTAATCCACAAGCCGCCAATCCACCCCAGCCGCCGCACCCGTCCCTGACAGCGCAGCCACCACCGGCCGCACTGCCCCCACC
CACGCAGCCACCTGCGCCACTCCCTCCACTCGCCCGACAACCAATTTCTTACCAGTACGGCATGCCGATCGACCCCGGGCCTTCATCCACCGCATCACCGACCACAGCCCCCATCCATAT
GATCCGCTTCCCACCATCCCCATCCCCCATCCCATCTTGGGCGCAGGGCGCGCCTACGGTTTCACCACCAGTGTACTCTGAGGCACTCCCGCGACCGGCGCTCACGACTTCCTTACCCAG
CAGCACCGTCGGTGGGCCTCCCGGGATGCTGTTAGGAGGCGGCGACGGTCCCCTGTTCCCGGGTCGGGGGCCCTTGCGCCCTCACGTACCCGCAGCGACAGCAGCATGGTCACCGTACCA
TGGGCTACCTCAGGACGACGACGTGGAGACCGCAGCCTACGGCGCTACTACAAACTGGATTTTGCCACATACGATGGCTCCGAGGATCCGCTGAACTGGCTAAATCATTGTGAGCAGTTC
TTCCGGGGGCAGCGCACGCCAGCCTCGGATCGCACGTGGCTGGCCTCGTACCATCTTAAGGGGCCGGCACAGACGTGGTACTATGCCCTGGAACAGGACGAGGGCATGCCGTCTTGGGAT
CGCTTCGCCGAGCTGTGTCGCCTTCGCTTCGGTCCAGCAGTGCGCGGTTCTCGCCTTGCGGAACTGGGACGCCTCCCCTTCCTGTCCACGGTCCAGGAGTACTCGGACCGCTTCCAGGCA
TTGCTGTGTCGAGCTCGGGACGTCTCCCCCATGCAGAAGACGGAGCTATTCGTGGGCGGCCTTCCCGAGTACTTGCGGGTGGACGTTGAGCTGCGCGACCCGCATGATCTACAAACTGCC
ATGTACCTGGCACGGGCGTTCGAACGGCGCGCGGCGGCCTGGCCCCCATTCCAGCAGCGCGGGTCGTGACCACCGCAACGGGCGCAGGGCTTGGGTCGCGTGACACCAGCACCGCCCGGG
GCTCTACCGACCGGTACGACGACGCCAGGCGATAGTACGACTCCGACACGCCCGTTTCGCCGATTGTCCCCGGGCGAGCAGCAGGAGCGGCGCCGGCAGGGGCTCTGCTTCAACTGCGAT
GAACCCTACGTTCGAGGACACGTCTGCCAGCGGCTGTTCTACTTGGAGGTCGACGACTTCCTCGACGAGGCGTCCGGTGAGGGTGGGGTCGACCCCCTTGAGGAGTCGGCCGCCCCAGAC
GTCACGGGAGCCAACGCGTTGGTGGTCTCGTTACACGCGCTGGCGGGCATCCGGACGGACAAGACGCTGCTGCTACCAGTCACCATCAACGGCGAGCGACTACTCGCGCTCATGGACACA
GGGTCAACCCACAACTTCCTCAACGCTGACACAATGAGCCGCCTCGGGTTAGCCATGGCGGGTGGCGAGCACCTTCGGGTCACGGTGGCCAACGGTGACCGCCTACCCTGCGCCGGCATC
GCCCGCGACGTCCCCGTCATCATCAACGACGAGTCCTTCTCCATCACGTGTGTTGGGATGCGCCTGGGCTGCTTCGACTTCATCCTCGGCGTGGACTTCCTGGAGACACTGGGCACCATC
CAGTGGAACTTCCGAGCACTGACCCTGTCGTTCCAGCGCCAGGGCCGGCGCATCCACTGGCAGGGTGTGCGGGCCACGCAACAGCCTGCCCCGCAGCAGCTGGTTGTGGCAGTCGTCGAC
ACTGCCCAACAGCCCCTCATGGACGTCCTTCTGCAGCAACATGGCGCCATCTTCGACGAGCCCACGGGACTGCCCCCGGCCCGCCCCTACGACCATCGCATCCACCTGCTGCCCGGTACA
GCTCCGGTGGCCGTACGACCGTACCGGTACGCACAGCTGCAGAAGGACGAGCTGGAGCGACAGTGTGAGGCCATGCTCACACAAGGCATCATACGACCCAGCACGTCGCCGTTCTCCGCT
CCGGTGCTCTTGGTTCGCAAGGCGGACCGCTCGTGGCGTTTCTGCATCGACTACCGCGCCCTCAACGCCAAGACGTCCAAGGACAAGTTCCCGATCCCGGTGGTGGACGAGCTCCTCGAC
GAGCTCCATGGAGCCCGTTTCTTCTCCAAGCTGGACCTACGCTCAGGCTACCACCAGGTGCGGATGCACACCGATGACATCGCCAAGACGGCGTTCCGCACCCATCATGGCCACTATGAG
TTCCTGGTCATGTCGTTCGGCCTCTCGAACGCGCCTGCTACGTTCCAGGCCCTGATGAACGACGTACTCCGCCCATATCTTCGGAAGTTTGTGCTTGTCTTCTTCGACGATATCCTGATC
TACAGTGCATCATGGGCGGAGCACCTCCAGCATGTGGGCATCGTCCTCGAGACATTGCAGGCAAACCACCTCCACCTGAAGCGCTCCAAGTGTTCCTTCGGCGCCACATCAGTGGCCTAT
CTGGGCCATGTCATCTCCGAGGGCGGGGTCGCCATGGACGCCGACAAGGTCGCGGCAGTGGCCTCCTGGCCGCCCCCGCGGTCTGCACGAGGCCTCCGGGGCTTTTTGGGACTAGCAGGG
TACTACCGGAAGTTCATCAAAGACTTCGGCCTCATCGCAGCCCCGCTGACACGTCTCTTGCGACGAGACGCGTTTGCCTGGGACGATGACGCGACAACAGCCTTCCACGCCCTAAAGCAC
GCCCTAACGACGGGTCCAGTGCTCCAGATGCCAGACTTCGCCAAGCTCTTCGTCGTCGACTGTGACGCGTCAGGTGCAGAGTTCGGTGCTGTCCTTCATCAGGGCGCGAGACCTCTCGCC
TACTTCAGCAAGCCATTTGCAGCCCGCCACCTTAAGTTGGCGGCCTACGAGAGGGAGCTCATCGGCCTCGTGCAGGCCGTCCGTCACTGGCGCCCGTACTTGTGGGGGCGCCACTTTTCT
GTTCGGACTGACCACTACAGTCTCATTCTTGCTGGATCAGCGCTTGTCCACAGTTCCTCAGCATCAGTGGACCAGCAAGTTGTTCGGTTTCGATTTCTCGGTGGAATACAGGCCGGGGCG
CCTGAACACCGTGGCCGACGCCCTGTCCCGCCGCGACTCGGAGGCCGCCGTGGAGGACACGGCTATGGCAGCACTGGCCATCTCGGGCCCGACATTCTCCCTGCTGGACGACATCAGGCG
AGCGCTGGCAGCTGCACCTGACGGGCAGCACCTCCTCCAGCAGCTGCGGGACGGCGTATTGGCTGCGCCATGGCGCCTCGTCGACGGGCTGCTCCTGCACGGCACACGCATCTTCGTGCC
GAACTACGACGACCTGCGCCACCAGGTGCTGACACTGGCGCACTCGGCAGGTCATGAGGGCATCCAGAAAACCCTCCATCGACTACGGACAGACTTCTACATGCCACATGATCGCGCGCT
CGTCCAGGACTGGGTGCGCACCTGCACCACGTGCCAGCAAAACAAGACACTGGCGCAGCAGCGGGGCGGCCTCCTGCAACCCCTTGAGGTGCCGTCCCAGGTGTGGGTCGACATCTCCAT
GGACTTCATCGAGGGGCTGCCCAAGGTGGCAGGCAAGTTCGTCATCCTCACGGTGGTGGATCGCTTCTCCAAATACGCCCACTTCATCGCCCTCGGCCACCCCTACACCGTGTCGTCCGT
AGCACGGGCATTCTTCGACGGCGTCGTACGACTGCACGGGTTCCCGTTGTCTATTGTCAGTGACCGGGACCCCGTCTTCACCGGGCACGTGTGGCGCGACCTCTTCAGGATGGCGGGGGT
GACACTAAAGATGAGCATCGCCTTCCACCCACAGACGAATGGACAATCGGAGGTGGTCAACAAAATTATTGCGATGTATCTTCGGTGTGTCATCGGCGATCGACCGCGGGCATGGGTGGA
TTGGCTGTCCTGGGCGGAGTATTGCTATAATACCTCCTACCACACAGCATTGCGTGCCACTCCCTTCGAGGTGGTCTATGGTAGATCCCCACCGTCCATGCTACCTTACACGCCAGGGAC
GACACGTACTGAGGCCGCAGACGACATGCTACGCTCCAGAGATGAGACGCTGGCCGAGGTGCGCCAGCGCCTTTTGCAGGCCCAACAGCTCGCCAAGAAGTATTACGATGTCGGGCATCG
GGAGGTCCAGTTCCATGTGGGCGACTGGGTGTGGCTACGCCTGCTACACCGCACCTTTCAGTCCCTCCATCCGCGCGCGAAGGGAAAGCTGGGACCTCGCTACGCAGGCCCTTTCCGTGT
CCAGGAAAGGATTGGGTCGGTAGCCTACCGCCTGCAGTTGCCAGATGGTGCTCGCATCCATGATGCCTTCCACGTCAGCCTGCTGAAGCCGCATCGTGGGGATCCTCCTGCAACTCCGGG
GACGCTTGACCCAGTGATGGATGGTCGGCTGCTTCCTGTGCCGGCCAAGGTGCTTCGCGCTCAACTTAGGCGGGGCGTGTGGCAGGTTCTCGTACAGTGGCGTGGACTGGCTGAAGATGA
CGCCACATGGGAAAAGCTTGAAGAGTTCCGTGCTGCTTACCCCAACTTACAGCTCGAGGACGAGCTGTTTGAGAAGGCGGGGAGAGATGTTATGTATGGCCAAGCCTATGTTAGGCGCAA
TAGGGCCAAGGCTGCCCAGGTGGGGCCCAAGGCCCAATAGCTAATAGATAAGCTCTATCTAGTTAGTTATACTTATCCAAAGATAGTAGATAAAGATCAACTCTATCTAGATAGTTATAC
TTATCCAAAGTTAGTAGATAGACTTGAGATAGCTCTATATATAGATCTGTAAACTCTGGAATAAAGACAAGCAGAATTCCAATCTATTCTGGCTTCCCAGAGGGAGCCAGAATCTCCTGT
GATCTTCTCCCTGCGCACAACCCAGCCAGGATCACGACGGCGCCCCAGCGCCGCCACCCTGGTCCCACCAAATCCCCTCCCTACAATCTGCGCAATCTGCCCGGTAGAATCCGTAGTTCT
ACCATGCCTTTTGCCACATATTACATGCTGAAAAATTTATCCGAGTTCATCATCTCTTATCTGGTAGCAATACTTCAGGATATCAAAGAGAAACGAGATCAGGATCTTCTGGTCCTACCT
ACAGATGCTGCTTTATTTGAGGACCCAAAGTTCAAG
GTGATCTCTGATGATCAACTGTATGATGTTGGTATTCTATGAATTTAATTGTTGAGCTTACTTTACTCTATGAGAATCCACAAC
ACAACCAGGTCTATGCGGAGAAATATGCAGAGGACCAAGACGCATTCTTCAGAGACTACGCTGAGGCTCATGCTAAACTGAGCGAATTGGGTGCAAAGTTCCAACCACCGCAGGTTAGTG
TTAACATTTCCGTCCTTAGTTTTCCTTCAAGTACACTTTGGTTTTCATTAAAATGGCAATTTAATTGGTTATGGGTAGGAAACTAGCTGCTCAAAAACCACTGATGATTTTTCTTTTCCT
CAAACAATTTGGACCAACCTTATCGTCCTTTTTAATATTGATTCTGCAGGGATTCTCTTTGGATGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGCCTCGCAGCATCCGCCGCCACCCTCCGCGCCTCGGCCGCCGCCACCCCATTCGCCCGCCGCGCGGCGCCGGCCAACCGCGCCTTCTTCTCGCCTTCGCTAGCTCGCGCG
CGCGTCGGCCTCCGCGCCGCGCCCTCTTCGCTCCCACAG
AAGGCGAGGGCAGTGAGGTGCGCGGCTGTGGCGATGGCGTCTGACGCGGCTCAGGTGAAGGCCGCACGCGAGGACATCAGG
GAGCTTCTCAGGACGACTCACTCCCACCCCATCCTG
GTCCGTCTAGGATGGCATGATGCTGGTACGTATGACAAGAATATTGAGGAGTGGCCACAACGAGGTGGAGCTAATGGAAGTTTA
AGATTTGATGTTGAGTTGAAACATGGAGCCAATGCTG
GTCTGATAAATGCTCTAAAGCTTATCCAACCAATCAAGGACAAGTACCCTAGTATCACTTATGCAGATTTATTTCAGTTGGCA
AGTGCTACAGCAATTGAG
GAAGCTGGTGGCCCAAAGATTCCAATGAAATACGGACGAGTTGATGTTACAGGACCTGAGCAGTGCCCCCCTGAGGGGAAACTTCCTGATGCTGGCCCAAGT
TCACCTGCTGACCACTTGAGGGAGGTATTCTACAGAATGGGCCTTAATGACAAG
GAAATTGTTGCCTTGTCTGGAGCACATACACTTGGAAGGTCCAGGCCTGAACGGAGTGGCTGGGGG
AAACCAGAAACAAAATATACT
AAAAATGGTCCTGGTGCACCTGGTGGGCAATCATGGACAGTTGAATGGCTGAGGTTTGATAACAGTTACTTCAAGGATATCAAAGAGAAACGAGATCAG
GATCTTCTGGTCCTACCTACAGATGCTGCTTTATTTGAGGACCCAAAGTTCAAG
GTCTATGCGGAGAAATATGCAGAGGACCAAGACGCATTCTTCAGAGACTACGCTGAGGCTCATGCT
AAACTGAGCGAATTGGGTGCAAAGTTCCAACCACCGCAG
GGATTCTCTTTGGATGATTAG

Retrieve as FASTA