Entry information : ZmAPx08 (APx8 / GRMZM2G006791[6a])
Entry ID 6711
Creation 2009-04-16 (Christophe Dunand)
Last sequence changes 2009-04-16 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-01-05 (Catherine Mathe)
Peroxidase information: ZmAPx08 (APx8 / GRMZM2G006791[6a])
Name (synonym) ZmAPx08 (APx8 / GRMZM2G006791[6a])
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation Thylakoid-bound
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmAPx08
start..stop
S start..stop
SbAPx08 791 0 1..451 1..454
SiAPx08 736 0 1..451 1..478
OsAPx08 697 0 27..451 31..478
HvAPx07 691 0 1..451 1..446
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 172396768..172396926 159 N° 2 172396529..172396657 129 N° 3 172395897..172396017 121 N° 4 172395424..172395524 101
N° 5 172395245..172395332 88 N° 6 172395046..172395113 68 N° 7 172394881..172394967 87 N° 8 172394282..172394356 75
N° 9 172394067..172394168 102 N° 10 172393880..172393984 105 N° 11 172392453..172392620 168 N° 12 172392203..172392355 153
complement(join(172392203..172392355,172392453..172392620,172393880..172393984,1 72394067..172394168,172394282..172394356,172394881..172394967,172395046..1723951 13,172395245..172395332,172395424..172395524,172395897..172396017,172396529..172 396657,172396768..172396926))


exon

Literature and cross-references ZmAPx08 (APx8 / GRMZM2G006791[6a])
Protein ref. UniProtKB:   B4G232   B6TEY2 [Different splicing]
DNA ref. GenBank:   AC197673.3 (3998..451)
mRNA ref. GenBank:   EU963547.1
Cluster/Prediction ref. UniGene:   Zm.66931
Protein sequence: ZmAPx08 (APx8 / GRMZM2G006791[6a])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   451
PWM (Da):   %s   48786.49 Transmb domain:   %s   o431-450i
PI (pH):   %s   5.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERLAASLLPAASPSPSARRATVAAAAAASFPSPCSARAGLRLRSRPPLFSQKAAGRGCGLRVVRCMAASDAVQLKAAREDIKELLKSTYCHPIMVRLGWHDSGTYDKNIKDWPQRGGANGSLRFDAELSHGANAGLINALKLIQPIKDKYPGITYADLFQLASATAIEAGGPKIPMKYGRVDVTAAEQCPPEGRLPDAGPRDPAEHLREVFYRMGLDDEIVALSGAHTLGRARPDRSGWGKLETKYTKDGPGEPGGQSWTVEWLKFDNSYFKDMKFLSQLPWKEQKEQDLLVLPTDAALFEDPSFKVYAEKYAEDQEAFFKDYGEAHAKLSDLGAKFDPPEGFSLDDDTCSSPSDEKTEEPTLVAVGAAVATATADDNNGAAPQPEPFIAANYSYGKRELSDAMKQKIRAEYEGFGGSPDKPMQSNYFLNIMILIAGLAFLTSLLGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 11 introns) and 63 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCCTCGCCGCCTCCCTCCTCCCTGCCGCCTCGCCGTCCCCGTCCGCCCGCCGCGCAACGGTCGCAGCCGCAGCCGCCGCCTCTTTCCCCTCCCCATGCTCCGCCCGCGCG
GGGCTGCGCCTACGCTCCCGCCCGCCCCTCTTCTCGCAG
GTTCCCTTTTAATTTGCTCGCGCCGGTCGATATGAGGTTGTCGCTTACATAAGATCGAATCGAGCTGCTCTGACTGACCTC
GTAGTGGTGGTGGGGTTGCGTGCGCGCAGAAGGCGGCCGGGCGCGGGTGTGGCCTGCGGGTGGTGCGGTGCATGGCAGCGTCGGACGCGGTGCAGCTCAAGGCCGCGCGGGAGGACATCA
AGGAGCTCCTTAAGAGCACATACTGCCACCCCATCATG
GTACACAACAACATACCGTCCTCCTCCCTTTCGAGTCTCGAGGAGCTACCCGTTGGAGGAAGCCGTAGAAGGATTTGTCTAC
CTTTGTTCTACATAGTGACTTGCTATCAAAATCAGTGTTTCAGTGATACTATATGTTATGTCTATATGACATTGTGCTTGTTTCCCTTGCATTTTACTGGGCTGAGCAGTGGAAATTAGT
TCCGTGTACCATTGCACTGGGTTATTTAGTCACTATCCATTTGACTGGTTAGTCGCACTATCTCATCCTGCATCACTGTATGCATTGACTTTATTTAAGTCTTTGTTTGGTTGCCTGTAT
ACTTGAAGCGTGAGCTGCATTAGTGGATGTAAAATAATTTATTTTGAGACTGTTTAACTGCATCTGCTCATATGTCAAAAACTTCGGTTTCTAGCCAGCCTGAATGGCACGAGCCTGGTT
ATGTACCAACTATGTCCCTGTAGTCATTTTGTGTTTTGTCAATAAGTTAATGCTTTTCACTCTGTTCAGGTCCGTCTGGGGTGGCATGATTCTGGTACCTATGACAAGAATATTAAGGAC
TGGCCACAGCGAGGTGGAGCTAATGGAAGTTTAAGGTTCGATGCTGAGCTGAGTCATGGAGCCAATGCGG
GTATTTCCTACTTTCTTGCTAGTGGTTGCGAATTTCACAGTGGCTTAAAA
AAAATCCTCTTGTCTATCCGACACCAAAACATAGGTCTAAGGTCTAGTTTCGGTTGTGTTCGTTCTCACGTGGGCTACAGTACCATTGTGTATGGACATATGTCTCAAACCTAGTTTTGG
TCGTGGTCGATCTCTCATGGGTTACGGTTTTACCGCTACGTATGGGTGACAGTCTAAGCCTCTAAGGGTTTTATTGAGAAGATTTTTTCTTAATACAATACACAGGGGTTATCTTAGCCC
TCAGGTCATTTTTTTTACAGTCTGAATTTCTTACACTTTCTAGGTCAGTAGTAACTTGTAGATTTTGACTTGATTTTCACAGGCCTGATTAATGCATTGAAGCTTATCCAGCCTATCAAG
GACAAATACCCAGGTATCACTTATGCAGATTTGTTCCAGTTAGCAAGTGCTACGGCGATTGAG
GTCACTGTCCTTTCTCTGATTAAGTATCTGACTTGGTCACTTTATCACTCAAGTCTA
TGCAGTCATATGTTTTGTCAATCACATGATACAGGAAGCTGGTGGTCCAAAAATTCCAATGAAATATGGACGTGTTGATGTCACAGCAGCTGAACAGTGTCCGCCCGAGGGGAGGCTTCC
TG
GTCAGTGTTTCTAATGGGTTCTTCATTCCATATCAATGTTTCATTGTTGTTTTGTTCAATGCTTGGAATGTGACTTATGAGAGGTGCCTATCAAGGTTGCCGGAATTGTTGCTAATGC
ACATGTTCTGCAGATGCTGGCCCACGTGATCCTGCTGAACACCTTAGGGAGGTATTTTATAGAATGGGCCTTGATGACAAGGTGTGGTGATTTCGAAACTTAACTGTCTATCTGTATTTT
CTAGAGCTATGTCATTGAACTTTCGGGACATTTGTGCAGGAAATTGTTGCACTATCTGGAGCACACACACTTGGAAGAGCAAGGCCTGACCGGAGTGGCTGGGGAAAGCTAGAAACAAAA
TATACT
GTATGTTTTTATGGTCTATTTTCTTCAGTTTAAATAAGAAACAATAGGTTATTCTCAGGAATTCAGAGTTTTTGGGCCTGCTTGAACCATCCACTGTCCCTTATCCTGTTTTTT
TAGTACGGAACACACAATTTGCTATCATATTCTGACTTCCAATTCCTGGGGTACTTTTCCTTACAGTGGAATTACCTGATAAGACTTGATAACTTTTTTTGATGAAACGATAAGACTTGA
TAACTTCTACACTCCGGACTCCTTTTGCTAATGTTTAGTGTCAGAACATAATAAGATGCAAAAACTTACCTGATAGCATATTCTTGGTGTTGTACTATGATATGGATTGGCTGGGGCAGC
AGGAAGAACCCACGTGGGTCCCTGGACTGGTCCACTTGCCATAACATACTATGACAACTTCTGTTCTTCTCACTTCTCATACCCATACTATCTTTGCAAATTTCATTACCGGGCAGGTTG
TGAATCTGGTTAGTTTCAATTAACCAGTACTGAGGTGTTGCATTTTGCAGAAGGATGGGCCTGGTGAGCCTGGAGGGCAATCATGGACAGTTGAGTGGTTGAAGTTTGATAATAGTTACT
TCAAG
GTACGTTTCGTTTTTGTCGTGTTTATAGATCATATTATTCACTAGAATCTCTGATGATTATGCTGTTAACAATGCTTCAGGAGATGAAGTTATTTTTTTTGAACGAAATTCAGGA
CATGAAGTTTTTGAGCCAGCTTCCCTGGAAAGAGCAGAAGGAACAGGATCTTCTAGTTTTGCCTACAGATGCTGCATTATTTGAGGACCCATCGTTCAAG
GTTGAACTTGAGCTCAGCTT
GCAACTTCTGTTTTTTTTTCAAGATCGTTCTTGCATTGACTGAGAATCTATGGCACATTCAGGTATACGCAGAAAAGTATGCAGAGGACCAGGAAGCGTTCTTTAAAGACTATGGTGAAG
CTCATGCTAAGCTGAGCGATCTTGGTGCAAAGTTTGATCCTCCTGAG
GTTAGTGTTACCATCTATTTTGGCCTTCTACAGCAAGTCACAATTTTAGTAAATGAGTAAACAGACACTAGGA
CAATATCTATTCTGTAGGTCTTCCATGTAAAATGACTTACTTCCTCCGTTCCAAAATATAAGTCCTTTCAATATTTTTAGGTACATAGATGTTGCTATCTATCTAGAAATAATGCGTATC
TAGGTACATAACAAAAGCTATGGACCATAAAATTTGCAATGGAAGGAGTATTTAGTTCCTGTAGTTTGCTTGTTCTTTGCTTGATTTTTTTGTCTCGAATCACTCTAAAGAAACATATGG
TTTTTGTTAAAGTTGCTTAGGTCGAGTTTTAGAAAAAAACAGACAAGTTTTTTTTGTCCAGTTATATTTAATCTAATACGTACGCGTAGTAGGTTACATCATGATATCGTCCTTCAAATT
AAGCATGCACATGTACACGAAGAGACGGAGCTATAAATTTTTTTGAGGGATTGAATTAAATCATTATAGTATAGAAGCCTCTTATTAATTATACCGTGTATATTTAAAATTAAAATTGTA
GGGGGCTCCAGTGAGGCTCGGCTCTAGTGGACTCCATGGGCCTAAGGAGCGGTAGAGGGGCTCGAGGTCTACCTGCCCCACCGTTGCCTAGAATACGTTACATTATAGCATCTTCAAGAG
ACTCTTTATTTTTTACTCTCTATTTGACTATTTATTTATCGCTCCATAAATATTAAACTCTATATATAGCATCTCATTCCAACAGACTCTCCAACATGCAAGTTAGCTTGGCTAGCGAGA
GTTGCTAGCCAAATTTGGCTAGCGAGAAGGTTAATTTAGAGAGCCAGATAGTTTAGCAAGCTAAATGACTAGTCTATTGGAGAGTTATTATGCTAATAAGTAGCTAAAATTTAGCTTGAC
AAGCTATTTAGCTAGTCTCTTGGAAATGCTCTTATACTGGTTGCCATGTTATATTTATGATAAACCAAATTATGTTATATTTGAAGTTGCAAAATGCAAAGATTTACCACATCTAATAGA
TTGTGCATGCATTAATTAGATCTAGAAAAAAGATTTGATACATAAAACTTTCCTATTTTACAAAACAGAAAACTAAATAAATATAAATTTCACCTCTTACCTCATACTCATAGGAAGTAA
TAATTATTCTAACCACTTAAATGAATGACTCATAGTCATTTGCAAATATAAACGTTAATTAGTTGCAGCTTAACTTCATGCATGTCATGTAATAATTGCCATTCAGGGATTCTCACTCGA
CGATGACACATGCTCTTCACCTTCCGACGAGAAGACGGAAGAACCTACACTGGTAGCGGTAGGAGCGGCAGTAGCAACAGCGACAGCGGACGACAACAACGGCGCAGCTCCGCAGCCGGA
GCCCTTCATCGCTGCCAATTACTCGTATGGAAAG
GTAAAAGCACTTGCACTTGCCTCCTCTATTGAACTCTTACAATGCAGATGGCAGCTTGATGGTAAGCTGATCGAGCATGTTGCGGG
TGAACTCGCAGAGGGAGTTGTCGGATGCGATGAAGCAAAAGATCAGGGCGGAGTACGAGGGGTTTGGAGGCAGCCCGGACAAGCCCATGCAGTCCAACTACTTCCTCAACATCATGATCC
TGATTGCGGGGTTGGCGTTCTTGACGTCTCTGCTCGGGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAGCGCCTCGCCGCCTCCCTCCTCCCTGCCGCCTCGCCGTCCCCGTCCGCCCGCCGCGCAACGGTCGCAGCCGCAGCCGCCGCCTCTTTCCCCTCCCCATGCTCCGCCCGCGCG
GGGCTGCGCCTACGCTCCCGCCCGCCCCTCTTCTCGCAG
AAGGCGGCCGGGCGCGGGTGTGGCCTGCGGGTGGTGCGGTGCATGGCAGCGTCGGACGCGGTGCAGCTCAAGGCCGCGCGG
GAGGACATCAAGGAGCTCCTTAAGAGCACATACTGCCACCCCATCATG
GTCCGTCTGGGGTGGCATGATTCTGGTACCTATGACAAGAATATTAAGGACTGGCCACAGCGAGGTGGAGCT
AATGGAAGTTTAAGGTTCGATGCTGAGCTGAGTCATGGAGCCAATGCGG
GCCTGATTAATGCATTGAAGCTTATCCAGCCTATCAAGGACAAATACCCAGGTATCACTTATGCAGATTTG
TTCCAGTTAGCAAGTGCTACGGCGATTGAG
GAAGCTGGTGGTCCAAAAATTCCAATGAAATATGGACGTGTTGATGTCACAGCAGCTGAACAGTGTCCGCCCGAGGGGAGGCTTCCTGAT
GCTGGCCCACGTGATCCTGCTGAACACCTTAGGGAGGTATTTTATAGAATGGGCCTTGATGACAAG
GAAATTGTTGCACTATCTGGAGCACACACACTTGGAAGAGCAAGGCCTGACCGG
AGTGGCTGGGGAAAGCTAGAAACAAAATATACT
AAGGATGGGCCTGGTGAGCCTGGAGGGCAATCATGGACAGTTGAGTGGTTGAAGTTTGATAATAGTTACTTCAAGGACATGAAGTTT
TTGAGCCAGCTTCCCTGGAAAGAGCAGAAGGAACAGGATCTTCTAGTTTTGCCTACAGATGCTGCATTATTTGAGGACCCATCGTTCAAG
GTATACGCAGAAAAGTATGCAGAGGACCAG
GAAGCGTTCTTTAAAGACTATGGTGAAGCTCATGCTAAGCTGAGCGATCTTGGTGCAAAGTTTGATCCTCCTGAG
GGATTCTCACTCGACGATGACACATGCTCTTCACCTTCCGACGAG
AAGACGGAAGAACCTACACTGGTAGCGGTAGGAGCGGCAGTAGCAACAGCGACAGCGGACGACAACAACGGCGCAGCTCCGCAGCCGGAGCCCTTCATCGCTGCCAATTACTCGTATGGA
AAG
AGGGAGTTGTCGGATGCGATGAAGCAAAAGATCAGGGCGGAGTACGAGGGGTTTGGAGGCAGCCCGGACAAGCCCATGCAGTCCAACTACTTCCTCAACATCATGATCCTGATTGCG
GGGTTGGCGTTCTTGACGTCTCTGCTCGGGAACTGA

Retrieve as FASTA