Entry information : PplKat02
Entry ID 6720
Creation 2009-04-29 (Christophe Dunand)
Last sequence changes 2016-02-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-11 (Achraf Jemmat)
Peroxidase information: PplKat02
Name PplKat02
Class Catalase    [Orthogroup: Kat003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplKat02
start..stop
S start..stop
PcKat02 719 0 48..571 23..554
PcarKat02 706 0 39..571 17..541
PinvKat02 541 0 10..544 3..529
SbreKat02 532 0 14..544 7..529
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 117966..118242 277 N° 2 118296..118388 93 N° 3 118444..118504 61 N° 4 118565..118580 16
N° 5 118633..118657 25 N° 6 118709..118781 73 N° 7 118847..118887 41 N° 8 118935..118987 53
N° 9 119040..119080 41 N° 10 119132..119254 123 N° 11 119314..119374 61 N° 12 119436..119475 40
N° 13 119534..119648 115 N° 14 119702..119725 24 N° 15 119775..119840 66 N° 16 119893..119999 107
N° 17 120056..120090 35 N° 18 120210..120234 25 N° 19 120286..120416 131 N° 20 120475..120578 104
N° 21 120644..120848 205  
join(117966..118242,118296..118388,118444..118504,118565..118580,118633..118657, 118709..118781,118847..118887,118935..118987,119040..119080,119132..119254,11931 4..119374,119436..119475,119534..119648,119702..119725,119775..119840,119893..11 9999,120056..120090,120210..120234,120286..120416,120475..120578,120644..120848)


exon

Literature and cross-references PplKat02
Literature Martinez,D. et al., Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports unique mechanisms of lignocellulose conversion. Proc. Natl. Acad. Sci. U.S.A. 106 (6), 1954-1959 (2009)
DNA ref. JGI genome:   scaffold_152 (117966..120848)
EST ref. GenBank:   FL607519.1 [5' end]   FL607518.1 [3' end]
Cluster/Prediction ref. JGI gene:   112311
Protein sequence: PplKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   572 (553)
PWM (Da):   %s   64353.23 (62317.1)  
PI (pH):   %s   4.88 (4.83) Peptide Signal:   %s   cut: 19 range:19-571
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQLLHLAPVVFNLAAALAGGDLGTSPHAAARQDASDVSSAAAPGASPFRFDLNTGMYMQTQMSNEPAPELEYTTENGAPYINPYDAWKIGSNGPLLLEDYHLTELLGSFDRERIPERVVHAKGAGAHGYFVVTNSSFCRQYTMMDMLSEDDLITPVTVRISTVSGETGASDELRDPRGFAVKFRTRKGILDIVMNNTPVFFIRDPSKFPYFIHTQKRNPQTNLRDKDLFWDFLSSNPESMYQVMVLFSDRGTPYGMRHMHAWTGHSYRWIQSDGTWHYVKLYFETMQGVRNFTNAEATLIQGENPDFATQDLFDAIANETYPGWTVYARVMSPEQAENYTYNVLDLTKDWDDTVPYVEIGKMYLTQNPTNYFAEVEQAAFSPSHIVDGWAPSADPMLQGRMFAYSDTQRYRLGINHMVNAPITPVANFERAGKMNINGNQGTRPNYMSTLSRLGLYNRTYTLDSHQQWTGGAVQSLSAVTEIDFAWPRIFWNGLSEQDQQNLISNVIGHLGEVIDQGIRDRQVALFAHVNYTLGKAIADGVGVTEIANLSFPYGETWYNHTIYSDESTLFY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (20 introns) and 2 ESTs. Strain="Mad-698-R"

DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCTCTTGCATCTGGCCCCTGTTGTCTTCAATCTTGCTGCTGCTCTTGCTGGGGGAGACCTTGGGACATCCCCTCACGCCGCCGCGAGACAAGATGCGTCGGACGTGTCTTCAGCA
GCCGCACCGGGAGCCAGTCCTTTCCGTTTTGACCTCAACACCGGAATGTATATGCAGACACAGATGTCTAATGAGCCCGCGCCCGAGCTCGAGTACACGACCGAGAATGGGGCGCCATAC
ATCAATCCGTATGACGCTTGGAAAATTGGATCGAATG
GTAAGCGAGCCGTCTTGGTGTAGATGCAACTACCCACGCGGATGTCTGTGCAGGGCCACTGCTTCTGGAGGACTATCATCTGA
CCGAGCTCCTCGGCTCCTTCGACCGTGAGCGGATCCCTGAGCGGGTTGTTCACGCCAAAGGTG
GTAAGCACTCTCGACCAACCAACCTTGCAGACTTGCTCTGACTCCCTTGCCGAAGCT
GGTGCGCATGGCTACTTTGTAGTGACGAATTCGTCATTCTGCAGGCAGTACACCATGAT
GTATACTTTGCTCATCTTATGTGTCTGCTGCCAGGCTAATTGATCGTGCGTGTTGTATAGG
GACATGCTCAGTGAG
GTCGGCCACTCCGTTCATGAACTGTTAAATTCGCGTACTTACATACGAAAAGGATGATCTTATCACTCCCGTCACAGGTATGATACTAGCACTCACGAAAGATGA
CGCCGACTAAAGCCGTCTTGTAGTTCGCATCAGCACAGTCAGCGGCGAAACGGGAGCCTCGGATGAACTCCGCGACCCACGCGGTTTCGCAGTCAAGTCAGCCTTTCATTCCTCGTTCTC
TCATAATTACCACTGACTCATCGTGTGGGGCGACTTCTCAGATTCCGCACTCGCAAAGGTATCTTAGATATTGTAATGAACAGTAAGTTAGTGCATCACACCAGAGCATTGACTGATTAC
CTGTGCCAGACACGCCAGTCTTTTTCATCCGCGACCCCTCGAAGTTCCCATACTTCATTCATGTATGTCAACTGTCATCCCATCGCCCTATCATGCAGCTGATGCCGGCCATAGACACAG
AAGAGGAATCCACAGACCAATCTGCGAGACAAGGA
GTGAGTCCCCTACCTCTTCTTCGTGCGCTCTTTCTGATTATGCACACTCAGCCTGTTCTGGGACTTCCTGAGCTCCAATCCCGAG
TCTATGTACCAAGTCATGGTCCTCTTCTCTGACAGAGGAACGCCATATGGTATGAGACATATGCACGCATGGACCGGACACTCGTACCG
GTAAATATCTACTATCCATGAACTATGTGCT
GTGTTTTTTTTTCTGACTATCCCATCAGCTGGATTCAGTCGGATGGCACTTGGCACTATGTCAAGCTGTATTTTGAGACGATGCAAGGAGTATGTACATCTAGTTCCCGGCGACGGTACT
TCCTTTGACGGGCCTTGTCTGCTACCAAAGGTCCGGAACTTTACCAACGCCGAAGCAACTCTAATCCAGGGTGAGGGTTCGATCTTGTCTTGTATACTCGCTCAAGCTGTATTGAAATAT
TTGGATAGGCGAGAATCCCGACTTTGCGACACAGGATCTGTTTGACGCCATCGCCAATGAGACCTACCCGGGTTGGACAGTGTACGCTCGGGTCATGTCTCCTGAACAGGCTGAGAACTA
CAC
GTACGCAGCATTCTTCTCCGCTGATGGAATGGCTAACATGAAGCGTGCTCTAGCTACAACGTGCTAGACCTGACGAAGTATGATTGCTCGCCGATTTAACGGTAACGTCTCTGACTA
GAAATACAGGGACTGGGATGACACCGTTCCCTATGTCGAGATTGGCAAGATGTATTTGACGCAGAACCCGACGAAGTGCGTTATCCCTTCGTAATGTTTTCGATGGGCTACTGACGTTTT
TATCTAGTTACTTTGCGGAGGTCGAGCAAGCTGCGTTCTCTCCTTCCCATATCGTCGATGGTTGGGCACCGTCTGCGGATCCCATGTTGCAGGGACGTATGTTTGCCTACTCAGGTGAGA
TCTACGAAGAATCGAGTAATTGAACGCATCGTGATCGAGCTGGTGTACAGACACGCAGCGATACCGTCTCGGGATCAACCACATGGTATGTTTCGAAAAGTTGATTGTCAGTTGTCGCTT
GATGTCTGATTTTATTCTCAGCAAATTCCGGTAAAATCAAGTTTTAGAGCCGCTTTATAAGCCCCTGACCATTGACCCATTCAGGTCAATGCGCCTATTACCCCCGTCGGTATGTTTGCA
GATTGACTACCTCAGATTCCACGATCTCATCTCTGCCTAGCCAATTTTGAGCGTGCCGGCAAAATGAACATCAATGGAAACCAGGGAACCAGACCTAATTATATGTCGACTCTGAGCCGT
CTCGGCCTCTATAACCGTACCTACACCCTGGACTCCCACCAGCAGTGGACG
GTGAGAGCAATCACCGAGCGTACTTGCCCTTGGCACTGAACATTCGATCATATCGTAGGGAGGCGCCGT
GCAATCGCTCTCAGCAGTTACCGAGATCGACTTTGCATGGCCGCGGATCTTCTGGAACGGGCTCTCTGAACAGGATCAGCAGAATTTGATCAG
GCATGTGTATTCCTGTACAGAGCATTG
CCAAGGTGCTTTTTCTGACTCACTTTTGACCCATTCAGCAACGTTATCGGCCACCTTGGCGAGGTGATCGACCAGGGTATTAGGGATCGTCAGGTCGCCTTGTTTGCGCACGTCAACTAC
ACCCTTGGAAAGGCCATTGCAGACGGTGTCGGTGTTACTGAGATTGCCAATCTCAGCTTCCCTTACGGCGAGACGTGGTACAATCACACTATTTACAGCGACGAGAGCACGCTGTTTTAC
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCTCTTGCATCTGGCCCCTGTTGTCTTCAATCTTGCTGCTGCTCTTGCTGGGGGAGACCTTGGGACATCCCCTCACGCCGCCGCGAGACAAGATGCGTCGGACGTGTCTTCAGCA
GCCGCACCGGGAGCCAGTCCTTTCCGTTTTGACCTCAACACCGGAATGTATATGCAGACACAGATGTCTAATGAGCCCGCGCCCGAGCTCGAGTACACGACCGAGAATGGGGCGCCATAC
ATCAATCCGTATGACGCTTGGAAAATTGGATCGAATG
GGCCACTGCTTCTGGAGGACTATCATCTGACCGAGCTCCTCGGCTCCTTCGACCGTGAGCGGATCCCTGAGCGGGTTGTTCAC
GCCAAAGGTG
CTGGTGCGCATGGCTACTTTGTAGTGACGAATTCGTCATTCTGCAGGCAGTACACCATGATGGACATGCTCAGTGAGGATGATCTTATCACTCCCGTCACAGTTCGCATC
AGCACAGTCAGCGGCGAAACGGGAGCCTCGGATGAACTCCGCGACCCACGCGGTTTCGCAGTCAA
ATTCCGCACTCGCAAAGGTATCTTAGATATTGTAATGAACAACACGCCAGTCTTT
TTCATCCGCGACCCCTCGAAGTTCCCATACTTCATTCAT
ACACAGAAGAGGAATCCACAGACCAATCTGCGAGACAAGGACCTGTTCTGGGACTTCCTGAGCTCCAATCCCGAGTCTATG
TACCAAGTCATGGTCCTCTTCTCTGACAGAGGAACGCCATATGGTATGAGACATATGCACGCATGGACCGGACACTCGTACCG
CTGGATTCAGTCGGATGGCACTTGGCACTATGTCAAG
CTGTATTTTGAGACGATGCAAGGA
GTCCGGAACTTTACCAACGCCGAAGCAACTCTAATCCAGGGCGAGAATCCCGACTTTGCGACACAGGATCTGTTTGACGCCATCGCCAATGAGACC
TACCCGGGTTGGACAGTGTACGCTCGGGTCATGTCTCCTGAACAGGCTGAGAACTACAC
CTACAACGTGCTAGACCTGACGAAGGACTGGGATGACACCGTTCCCTATGTCGAGATTGGC
AAGATGTATTTGACGCAGAACCCGACGAA
TTACTTTGCGGAGGTCGAGCAAGCTGCGTTCTCTCCTTCCCATATCGTCGATGGTTGGGCACCGTCTGCGGATCCCATGTTGCAGGGACGT
ATGTTTGCCTACTCAG
ACACGCAGCGATACCGTCTCGGGATCAACCACATGGTCAATGCGCCTATTACCCCCGTCGCCAATTTTGAGCGTGCCGGCAAAATGAACATCAATGGAAACCAG
GGAACCAGACCTAATTATATGTCGACTCTGAGCCGTCTCGGCCTCTATAACCGTACCTACACCCTGGACTCCCACCAGCAGTGGACG
GGAGGCGCCGTGCAATCGCTCTCAGCAGTTACC
GAGATCGACTTTGCATGGCCGCGGATCTTCTGGAACGGGCTCTCTGAACAGGATCAGCAGAATTTGATCAG
CAACGTTATCGGCCACCTTGGCGAGGTGATCGACCAGGGTATTAGGGAT
CGTCAGGTCGCCTTGTTTGCGCACGTCAACTACACCCTTGGAAAGGCCATTGCAGACGGTGTCGGTGTTACTGAGATTGCCAATCTCAGCTTCCCTTACGGCGAGACGTGGTACAATCAC
ACTATTTACAGCGACGAGAGCACGCTGTTTTACTAA

Retrieve as FASTA