Entry information : PplKat04
Entry ID 6721
Creation 2009-04-29 (Christophe Dunand)
Last sequence changes 2009-04-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-17 (Catherine Mathe (Scipio))
Peroxidase information: PplKat04
Name PplKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplKat04
start..stop
S start..stop
PplKat03 1292 0 1..745 1..743
PcarKat05 1221 0 4..745 2..740
PcKat04 1211 0 4..745 2..740
PcarKat04 1201 0 4..745 2..742
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 188409..188569 161 N° 2 188742..188793 52 N° 3 188847..188894 48 N° 4 188949..189107 159
N° 5 189171..189387 217 N° 6 189446..189646 201 N° 7 189704..190193 490 N° 8 190243..190901 659
N° 9 190960..191210 251  
join(188409..188569,188742..188793,188847..188894,188949..189107,189171..189387, 189446..189646,189704..190193,190243..190901,190960..191210)


exon

Literature and cross-references PplKat04
DNA ref. JGI genome:   scaffold_117 (188409..191210)
mRNA ref. JGI transcript:   112060
EST ref. GenBank:   FL621028.1 [3' end]   FL621029.1 [Fragment]
Protein sequence: PplKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   745
PWM (Da):   %s   83130.83  
PI (pH):   %s   6.62
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSAITNAAKQVFTAATQTAKIADLQRDIIDPSTKPTKGLTNDHGVFVSDTDNWLKAQDHGTVGPSLLEDMAREKIHRFDHERIPERVVHARGVGAHGYFKVYNDSAAKYTYAPVLTDSSRTTPVFARFSTVQGSRGSADTVRDVRGFAVKFYTQEGNWDIVGNDIPVFFIQDAIKFPDFVHAVKPEPHNEVPQGQSAHNNFWDYVGLQPESAHMIMWVMSDRGIPRSLRMMQGFGVNTYMLMNAKGERYFVKFHFLPELGVHSLVWDEALKLAGQDPDFHRKDLEEAITTGAYPKWKFAIQTIPEAREHDFEFDILDATKVWPEELIPLEIIGEMVLNRTVDEYFPETEQVAFCTSHVVPGIGFSNDPLLQGRNFSYQDTQLTRLGVNWQELPINRPVCPVLNFQRDGQLRHKITKGSINYWPNRQGIGRPVPTSEGGYADFPQAVQGIKLRERGHKFQEYFDQAQLFYNSLAPHEKAHVVAAISFELSHCDDPVVYETYSKILNNIDFDLAREVATNVGGIVPDRPARQNHGKSTPTLSQLYYAPKEPTIVSRRIAILLADGFSMAEVEGLRAAFKAGQATTWIIGPRRGWIHPKGEGSGSSVGVWADHHFEGQRSTMYDAFIIPSGPEHAQNLAQNGRTVHWIREAFGHCKAIGALGGVTFLREAVQLPGVQFAHDLRSNSVTNSYGVVTAGTYDAGSIVADTLKIEQDSKGFISTFALAVSKHRCYERELEGLTAKVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAGTGCAATTACGAACGCCGCTAAGCAGGTCTTCACTGCTGCCACGCAGACCGCTAAGATCGCAGACCTCCAAAGAGACATAATCGACCCGTCCACGAAGCCGACAAAAGGGCTC
ACAAACGACCATGGTGTCTTCGTCTCCGACACCGACAACTG
GTGCGCACGGTCCATTTCGCTGACATCACAATCATCTTTGGTCATTCCCCCGTCGGATATCACTGCATGCTCCATCTAG
TATGATATCTAGCGCATATATGCAGCCTTTAGGCTTCCGCTCCCTCTGTTCATGGTCGAGACACCGTCGGTGTTGACGTATAATCCTTTTCAGGCTCAAGGCGCAGGACCATGGCACTGT
CGGGCCATCTCTCCTGGAAGACCAC
GTGTGTCCAGTTCCTGCGCTGATGGTTACCATCTGCTTACGATTGCTCGTTAGATGGCCCGAGAGAAGATTCACCGTTTCGATCACGAGCGGATC
CCTGAG
GTACACACTCGCGCTTCATGTTGCTTTGCATTTGATTTAAGTGCCCCCGACTAGCGCGTTGTGCATGCTCGCGGTGTGGGCGCTCATGGCTACTTCAAGGTGTACAACGACAGC
GCTGCCAAGTACACGTATGCGCCAGTCTTGACAGACTCTTCGAGAACAACTCCGGTCTTTGCGCGATTCAGTACTGTCCAAGGGTCTCGCGGAAGCGCT
GTACGCCTCTTCCTGACTTGC
AAGACTGCAGTGTTTGTTGACATATGACGCCCGTAAAACTAGGACACCGTACGCGACGTTCGCGGGTTCGCAGTCAAATTCTACACCCAGGAAGGAAACTGGGATATAGTCGGCAATGAC
ATTCCAGTCTTCTTCATTCAGGATGCGATCAAGTTCCCAGACTTCGTCCACGCGGTTAAGCCAGAGCCCCACAACGAGGTGCCCCAAGGACAAAGCGCGCACAACAACTTTTGGGATTAT
GTGGGACTACAGCCCGAGT
GTGCGTTTCTCTTTGGTAAGATTGCTAGAGTCCCTTGTCGCTGATCATCTCCTATTAGCCGCGCACATGATTATGTGGGTAATGTCCGATCGCGGCATCCC
TCGGTCGCTTCGCATGATGCAAGGCTTCGGCGTCAATACATACATGTTAATGAACGCTAAAGGAGAGCGTTACTTCGTGAAATTCCACTTCCTACCGGAGCTTGGCGTTCATAGCCTGGT
GTGGGACGAGGCGCTGAAATTGGCTGGGCAGGATCCCG
GTAAGGGTTTTCTTTTTCGCCGCCGACTGCGTGGTGTTTACATGTCTCCTACCCGAGATTTCCATCGCAAAGACCTCGAAGA
GGCGATTACAACAGGTGCTTATCCGAAGTGGAAGTTTGCTATTCAGACCATCCCGGAGGCGCGCGAGCACGACTTCGAATTCGATATTCTCGACGCGACGAAAGTTTGGCCCGAGGAGCT
CATTCCTCTGGAGATTATCGGCGAGATGGTGCTGAACAGGACGGTCGATGAATATTTCCCGGAGACGGAGCAAGTCGCGTTTTGTACTTCCCATGTTGTTCCCGGTATCGGCTTCAGCAA
CGACCCTCTACTCCAGGGCAGGAACTTCTCTTACCAGGACACGCAGCTCACGCGCCTCGGAGTAAACTGGCAAGAGCTTCCGATAAACCGCCCTGTCTGTCCGGTTCTCAACTTCCAGCG
AGACGGGCAACTCAGGCACAAGATTACGAAGGGCAGTATCAATTACTGGCCTAACCGTCAAGGTATCGGAAGGCCGGTACCTACGAGCGAGGGGGGCTACGCTGA
GTCAGTCGTTTGCTG
GGGGCTATTCTACTAATCTAATTTCATGACGTAGTTTCCCTCAGGCAGTTCAAGGTATCAAGCTGCGCGAGCGTGGTCACAAGTTCCAGGAATACTTTGATCAGGCGCAGCTGTTCTACA
ACTCTCTTGCTCCGCACGAGAAAGCACACGTCGTTGCTGCCATCTCTTTCGAGCTCAGCCATTGCGACGATCCCGTTGTGTACGAGACATACTCCAAAATCCTGAACAACATCGACTTTG
ACCTCGCTAGAGAAGTGGCCACCAACGTTGGCGGCATTGTTCCAGATCGACCTGCTCGTCAAAATCACGGAAAGTCGACACCGACATTGTCCCAGCTTTACTATGCGCCCAAGGAACCGA
CGATTGTCTCGAGGAGGATTGCGATCCTCTTAGCTGATGGGTTCTCCATGGCAGAGGTCGAAGGCCTAAGGGCTGCATTCAAGGCAGGCCAGGCGACGACGTGGATTATTGGGCCGAGAC
GAGGATGGATCCACCCGAAGGGGGAGGGCTCGGGATCTAGCGTAGGTGTATGGGCTGACCATCACTTCGAGGGACAAAGGAGTACGATGTATGATGCATTTATCATCCCGAGCGGTCCTG
AACATGCGCAAAACTTGGCGCAAAACGGCAGGACTGTTCATTGGATTAGGGAGGCGTTCGGTCACTGCAAGGCGATCGGTGCGCTGGGTGAAG
GTGAGCCGCCATGTCTCGCTGCCACTA
CGACAGGGCCCCAGGCTGATCTGAATCCCAGGAGTGACCTTCTTGCGCGAGGCTGTCCAGCTTCCAGGAGTGCAATTTGCCCATGATCTCAGGAGCAACTCCGTCACGAACTCGTACGGC
GTTGTTACCGCGGGGACCTATGACGCGGGGTCGATCGTCGCTGATACTCTGAAGATCGAGCAAGACAGCAAGGGCTTCATCTCCACATTCGCGTTGGCGGTCAGCAAGCATCGCTGCTAT
GAGCGCGAGCTGGAGGGATTGACTGCGAAGGTAGCGTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAGTGCAATTACGAACGCCGCTAAGCAGGTCTTCACTGCTGCCACGCAGACCGCTAAGATCGCAGACCTCCAAAGAGACATAATCGACCCGTCCACGAAGCCGACAAAAGGGCTC
ACAAACGACCATGGTGTCTTCGTCTCCGACACCGACAACTG
GCTCAAGGCGCAGGACCATGGCACTGTCGGGCCATCTCTCCTGGAAGACCACATGGCCCGAGAGAAGATTCACCGTTTC
GATCACGAGCGGATCCCTGAG
CGCGTTGTGCATGCTCGCGGTGTGGGCGCTCATGGCTACTTCAAGGTGTACAACGACAGCGCTGCCAAGTACACGTATGCGCCAGTCTTGACAGACTCT
TCGAGAACAACTCCGGTCTTTGCGCGATTCAGTACTGTCCAAGGGTCTCGCGGAAGCGCT
GACACCGTACGCGACGTTCGCGGGTTCGCAGTCAAATTCTACACCCAGGAAGGAAACTGG
GATATAGTCGGCAATGACATTCCAGTCTTCTTCATTCAGGATGCGATCAAGTTCCCAGACTTCGTCCACGCGGTTAAGCCAGAGCCCCACAACGAGGTGCCCCAAGGACAAAGCGCGCAC
AACAACTTTTGGGATTATGTGGGACTACAGCCCGAGT
CCGCGCACATGATTATGTGGGTAATGTCCGATCGCGGCATCCCTCGGTCGCTTCGCATGATGCAAGGCTTCGGCGTCAATACA
TACATGTTAATGAACGCTAAAGGAGAGCGTTACTTCGTGAAATTCCACTTCCTACCGGAGCTTGGCGTTCATAGCCTGGTGTGGGACGAGGCGCTGAAATTGGCTGGGCAGGATCCCG
AT
TTCCATCGCAAAGACCTCGAAGAGGCGATTACAACAGGTGCTTATCCGAAGTGGAAGTTTGCTATTCAGACCATCCCGGAGGCGCGCGAGCACGACTTCGAATTCGATATTCTCGACGCG
ACGAAAGTTTGGCCCGAGGAGCTCATTCCTCTGGAGATTATCGGCGAGATGGTGCTGAACAGGACGGTCGATGAATATTTCCCGGAGACGGAGCAAGTCGCGTTTTGTACTTCCCATGTT
GTTCCCGGTATCGGCTTCAGCAACGACCCTCTACTCCAGGGCAGGAACTTCTCTTACCAGGACACGCAGCTCACGCGCCTCGGAGTAAACTGGCAAGAGCTTCCGATAAACCGCCCTGTC
TGTCCGGTTCTCAACTTCCAGCGAGACGGGCAACTCAGGCACAAGATTACGAAGGGCAGTATCAATTACTGGCCTAACCGTCAAGGTATCGGAAGGCCGGTACCTACGAGCGAGGGGGGC
TACGCTGA
TTTCCCTCAGGCAGTTCAAGGTATCAAGCTGCGCGAGCGTGGTCACAAGTTCCAGGAATACTTTGATCAGGCGCAGCTGTTCTACAACTCTCTTGCTCCGCACGAGAAAGCA
CACGTCGTTGCTGCCATCTCTTTCGAGCTCAGCCATTGCGACGATCCCGTTGTGTACGAGACATACTCCAAAATCCTGAACAACATCGACTTTGACCTCGCTAGAGAAGTGGCCACCAAC
GTTGGCGGCATTGTTCCAGATCGACCTGCTCGTCAAAATCACGGAAAGTCGACACCGACATTGTCCCAGCTTTACTATGCGCCCAAGGAACCGACGATTGTCTCGAGGAGGATTGCGATC
CTCTTAGCTGATGGGTTCTCCATGGCAGAGGTCGAAGGCCTAAGGGCTGCATTCAAGGCAGGCCAGGCGACGACGTGGATTATTGGGCCGAGACGAGGATGGATCCACCCGAAGGGGGAG
GGCTCGGGATCTAGCGTAGGTGTATGGGCTGACCATCACTTCGAGGGACAAAGGAGTACGATGTATGATGCATTTATCATCCCGAGCGGTCCTGAACATGCGCAAAACTTGGCGCAAAAC
GGCAGGACTGTTCATTGGATTAGGGAGGCGTTCGGTCACTGCAAGGCGATCGGTGCGCTGGGTGAAG
GAGTGACCTTCTTGCGCGAGGCTGTCCAGCTTCCAGGAGTGCAATTTGCCCAT
GATCTCAGGAGCAACTCCGTCACGAACTCGTACGGCGTTGTTACCGCGGGGACCTATGACGCGGGGTCGATCGTCGCTGATACTCTGAAGATCGAGCAAGACAGCAAGGGCTTCATCTCC
ACATTCGCGTTGGCGGTCAGCAAGCATCGCTGCTATGAGCGCGAGCTGGAGGGATTGACTGCGAAGGTAGCGTACTAA

Retrieve as FASTA