Entry information : PplKat03
Entry ID 6723
Creation 2009-04-29 (Christophe Dunand)
Last sequence changes 2012-04-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-12 (Christophe Dunand)
Peroxidase information: PplKat03
Name PplKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplKat03
start..stop
S start..stop
PplKat04 1292 0 1..743 1..745
PcKat05 1226 0 19..743 19..739
PcarKat05 1226 0 19..743 19..740
PcKat04 1214 0 19..743 19..740
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..155 155 N° 2 212..263 52 N° 3 317..364 48 N° 4 418..793 376
N° 5 850..1050 201 N° 6 1105..1594 490 N° 7 1652..2310 659 N° 8 2369..2619 251
join(1..155,212..263,317..364,418..793,850..1050,1105..1594,1652..2310,2369..261 9)


exon

Literature and cross-references PplKat03
DNA ref. GenBank:   ABWF01003958.1 (1646..1) [5' end]   ABWF01010183.1 (1..1685) [3' end]
Cluster/Prediction ref. JGI gene:   59021 [5' end]   129985 [3' end]   99098 [Sequencing error]
Protein sequence: PplKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   743
PWM (Da):   %s   82348.77  
PI (pH):   %s   6.71
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSAIADAAKQLFGTANAKVTDLQSDTIDPASKPNKGLTTDNGVYVSDTDNWLKAQNGTTTGPSLLEDIGREKIHRFDHERIPERVVHARGVGAHGYFKVYNDKASKYTSAPVLTDPSRSTPIFVRISTVQGSRGSADTVRDVRGFAVKFYTQEGNWDIVGNNIPVFFIQDAIKFPDFVHAVKPELHNEVPQGQSAHNNFWDFVGLQPESAHMVMWVMSDRAIPRSLRMIQGFGVNTYTLMNAQGERFFVKFHWLPELGVHSLVWDEALKIAGQDPDFHRKDLQEAIENGAYPKWKFAIQTIPEANEHDFDFDILDATKVWPEELVPLEVIGEMVLNKTVDEFFPETEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQITRLGVNWEELPINRPVCPVMNHQRDGQMRHKITKGAINYWPNRKAIGAPVPTSEGGYADVAQKVAGIKQRVRTPKFQEHYNQAQLFYNSLTDYEKTHLVNAVSFELSHCDDPVVFQTYTKILNNIDFNLAKQVAINVGGTILEKPARENHGKSTPTLSQLYYAPKEPTIVSRRIAILVADGFNFAEVEGLRAALKLGQATTWIIGPRRGKVYPAGQVVGTGEGIWADHHHEGQRSTLFDSIIIPSGAEHAQRLAQNGRAIHWVREAFGHCKPIGALGGVAFLREAVQLPGVQLASSLKSDSVTTSYGVVTAGKYDAGSAVADTLKIAQGEKGFISNFAYEVSKHRCYEREAEGLTSKVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). No EST. 3 contigs from JGI.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCAGCTATCGCCGATGCGGCCAAGCAGCTCTTCGGAACCGCTAATGCCAAGGTCACTGACCTGCAGTCCGACACAATCGACCCTGCCTCGAAGCCCAATAAGGGCCTAACGACT
GATAATGGTGTCTATGTCTCTGACACTGACAACTG
GTGTGTGGCTCATACGCATACGAGACGAGAGACTATTAACTGACCGCGAATTTCAGGCTAAAGGCCCAGAACGGCACTACCACCG
GTCCCTCTCTGCTCGAGGACCAG
GTTGGTTGTTTCAACAAATGTCGCGTACATCGCAATAATAACACGTTTCATAGATTGGCCGCGAGAAGATTCACCGCTTCGACCACGAGCGCATACC
AGAG
GTACGATGACGCGCTGCGCCTTGGAATACTCCTGCTCACTGTCTTCCGTATAGCGTGTCGTCCATGCCCGTGGAGTCGGGGCTCATGGCTACTTCAAGGTGTACAACGACAAAGCG
TCCAAGTACACCTCTGCACCTGTCCTCACCGACCCCTCCCGCTCCACGCCCATTTTCGTGCGTATCAGTACCGTGCAAGGCTCTCGCGGCAGCGCGGACACCGTCCGCGATGTCCGCGGC
TTTGCTGTTAAGTTCTACACTCAAGAGGGCAACTGGGACATTGTCGGCAACAACATTCCCGTATTCTTCATCCAGGATGCGATCAAGTTCCCCGACTTCGTGCACGCGGTCAAGCCTGAG
CTGCACAATGAGGTCCCGCAGGGCCAGAGCGCGCACAACAACTTCTGGGACTTCGTCGGGTTGCAGCCCGAGT
GTGAGTATAGATGTCGTCATCACAATTGCCAATATGCTCACAATCGG
CCTTTACAGCCGCTCACATGGTTATGTGGGTCATGTCTGACCGCGCCATTCCGCGATCCCTCCGTATGATCCAAGGTTTTGGGGTCAACACTTACACTTTGATGAACGCGCAAGGCGAAC
GGTTCTTCGTCAAGTTCCATTGGCTTCCTGAGCTCGGCGTGCACAGCCTCGTCTGGGATGAGGCCCTAAAAATCGCGGGTCAAGATCCAG
GTATGCGGCATTCGTCCTGTGCCCTTTGAC
CTGCTTTTGACTGATTCTCTGCAGACTTCCACCGCAAGGACCTCCAGGAGGCGATCGAGAACGGTGCCTACCCCAAGTGGAAGTTCGCCATCCAGACTATTCCGGAGGCGAACGAGCATG
ACTTCGATTTCGACATACTCGATGCTACCAAGGTCTGGCCGGAGGAGCTCGTCCCGCTCGAGGTCATCGGCGAGATGGTGCTCAACAAAACTGTCGACGAATTCTTCCCCGAGACTGAGC
AGGTCGCGTTTTGCACTTCCCATGTTGTTCCCGGTATCGGCTTCAGCGACGACCCGTTGCTCCAGGGACGTAACTTTTCGTACTTCGACACTCAGATCACGCGCTTGGGTGTTAACTGGG
AGGAGCTCCCGATCAACCGACCCGTGTGCCCCGTCATGAACCACCAACGTGACGGACAGATGCGACACAAAATCACGAAGGGCGCGATTAATTATTGGCCGAACCGTAAGGCTATTGGCG
CCCCAGTGCCCACCTCAGAAGGCGGCTATGCTGA
GTGAGTCTTCCATCGAGTGTCAATCCTGCATGCAATATCTGATGGCGTCTTTGGCAGTGTCGCGCAGAAGGTTGCGGGCATCAAGC
AGCGTGTGCGTACGCCCAAGTTCCAGGAGCACTACAACCAGGCACAACTTTTCTACAACTCCCTGACCGACTATGAGAAGACGCATCTCGTGAACGCCGTCTCATTCGAGCTTAGCCACT
GCGACGATCCGGTTGTATTCCAGACATACACGAAGATCCTCAATAACATCGACTTCAACCTCGCAAAGCAGGTCGCAATCAATGTGGGCGGCACAATCCTCGAGAAGCCGGCGCGTGAGA
ACCACGGCAAGTCGACGCCGACGCTTTCCCAGCTTTACTATGCACCCAAGGAGCCGACGATCGTCTCGCGCCGCATCGCGATCCTTGTCGCAGACGGCTTCAACTTCGCCGAGGTCGAGG
GCCTGCGAGCCGCGCTCAAGCTTGGCCAAGCAACGACCTGGATCATTGGGCCCCGCCGCGGGAAGGTCTACCCCGCAGGCCAGGTGGTGGGCACCGGCGAAGGTATCTGGGCGGACCACC
ACCACGAGGGCCAGCGCAGCACGCTGTTCGATTCGATTATTATCCCGAGCGGCGCTGAGCACGCGCAACGGCTCGCGCAGAACGGACGTGCGATCCACTGGGTCCGCGAGGCGTTTGGCC
ACTGCAAGCCCATTGGCGCGCTCGGCGAAG
GTTGGTGCCGGTGCTGCTTCGTTCATTGAGCAAAAGATTGACTGAGATTTGCATACAGGTGTTGCATTCCTCCGCGAGGCCGTGCAGCTT
CCAGGAGTCCAGCTTGCATCGAGCTTGAAGAGCGACTCCGTGACAACCTCGTACGGTGTCGTAACCGCGGGCAAGTACGACGCAGGCTCCGCGGTCGCGGACACGCTCAAGATCGCTCAA
GGCGAGAAGGGCTTCATCTCCAACTTCGCGTATGAGGTCAGCAAGCACCGCTGCTACGAGCGCGAAGCGGAAGGCTTGACGTCGAAGGTTGCGTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCAGCTATCGCCGATGCGGCCAAGCAGCTCTTCGGAACCGCTAATGCCAAGGTCACTGACCTGCAGTCCGACACAATCGACCCTGCCTCGAAGCCCAATAAGGGCCTAACGACT
GATAATGGTGTCTATGTCTCTGACACTGACAACTG
GCTAAAGGCCCAGAACGGCACTACCACCGGTCCCTCTCTGCTCGAGGACCAGATTGGCCGCGAGAAGATTCACCGCTTCGACCAC
GAGCGCATACCAGAG
CGTGTCGTCCATGCCCGTGGAGTCGGGGCTCATGGCTACTTCAAGGTGTACAACGACAAAGCGTCCAAGTACACCTCTGCACCTGTCCTCACCGACCCCTCCCGC
TCCACGCCCATTTTCGTGCGTATCAGTACCGTGCAAGGCTCTCGCGGCAGCGCGGACACCGTCCGCGATGTCCGCGGCTTTGCTGTTAAGTTCTACACTCAAGAGGGCAACTGGGACATT
GTCGGCAACAACATTCCCGTATTCTTCATCCAGGATGCGATCAAGTTCCCCGACTTCGTGCACGCGGTCAAGCCTGAGCTGCACAATGAGGTCCCGCAGGGCCAGAGCGCGCACAACAAC
TTCTGGGACTTCGTCGGGTTGCAGCCCGAGT
CCGCTCACATGGTTATGTGGGTCATGTCTGACCGCGCCATTCCGCGATCCCTCCGTATGATCCAAGGTTTTGGGGTCAACACTTACACT
TTGATGAACGCGCAAGGCGAACGGTTCTTCGTCAAGTTCCATTGGCTTCCTGAGCTCGGCGTGCACAGCCTCGTCTGGGATGAGGCCCTAAAAATCGCGGGTCAAGATCCAG
ACTTCCAC
CGCAAGGACCTCCAGGAGGCGATCGAGAACGGTGCCTACCCCAAGTGGAAGTTCGCCATCCAGACTATTCCGGAGGCGAACGAGCATGACTTCGATTTCGACATACTCGATGCTACCAAG
GTCTGGCCGGAGGAGCTCGTCCCGCTCGAGGTCATCGGCGAGATGGTGCTCAACAAAACTGTCGACGAATTCTTCCCCGAGACTGAGCAGGTCGCGTTTTGCACTTCCCATGTTGTTCCC
GGTATCGGCTTCAGCGACGACCCGTTGCTCCAGGGACGTAACTTTTCGTACTTCGACACTCAGATCACGCGCTTGGGTGTTAACTGGGAGGAGCTCCCGATCAACCGACCCGTGTGCCCC
GTCATGAACCACCAACGTGACGGACAGATGCGACACAAAATCACGAAGGGCGCGATTAATTATTGGCCGAACCGTAAGGCTATTGGCGCCCCAGTGCCCACCTCAGAAGGCGGCTATGCT
GA
TGTCGCGCAGAAGGTTGCGGGCATCAAGCAGCGTGTGCGTACGCCCAAGTTCCAGGAGCACTACAACCAGGCACAACTTTTCTACAACTCCCTGACCGACTATGAGAAGACGCATCTC
GTGAACGCCGTCTCATTCGAGCTTAGCCACTGCGACGATCCGGTTGTATTCCAGACATACACGAAGATCCTCAATAACATCGACTTCAACCTCGCAAAGCAGGTCGCAATCAATGTGGGC
GGCACAATCCTCGAGAAGCCGGCGCGTGAGAACCACGGCAAGTCGACGCCGACGCTTTCCCAGCTTTACTATGCACCCAAGGAGCCGACGATCGTCTCGCGCCGCATCGCGATCCTTGTC
GCAGACGGCTTCAACTTCGCCGAGGTCGAGGGCCTGCGAGCCGCGCTCAAGCTTGGCCAAGCAACGACCTGGATCATTGGGCCCCGCCGCGGGAAGGTCTACCCCGCAGGCCAGGTGGTG
GGCACCGGCGAAGGTATCTGGGCGGACCACCACCACGAGGGCCAGCGCAGCACGCTGTTCGATTCGATTATTATCCCGAGCGGCGCTGAGCACGCGCAACGGCTCGCGCAGAACGGACGT
GCGATCCACTGGGTCCGCGAGGCGTTTGGCCACTGCAAGCCCATTGGCGCGCTCGGCGAAG
GTGTTGCATTCCTCCGCGAGGCCGTGCAGCTTCCAGGAGTCCAGCTTGCATCGAGCTTG
AAGAGCGACTCCGTGACAACCTCGTACGGTGTCGTAACCGCGGGCAAGTACGACGCAGGCTCCGCGGTCGCGGACACGCTCAAGATCGCTCAAGGCGAGAAGGGCTTCATCTCCAACTTC
GCGTATGAGGTCAGCAAGCACCGCTGCTACGAGCGCGAAGCGGAAGGCTTGACGTCGAAGGTTGCGTACTGA

Retrieve as FASTA