Entry information : PplHalPrx01
Entry ID 6729
Creation 2009-04-30 (Christophe Dunand)
Last sequence changes 2009-04-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-17 (Catherine Mathe (Scipio))
Peroxidase information: PplHalPrx01
Name PplHalPrx01
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplHalPrx01
start..stop
S start..stop
PplHalPrx03 578 0 1..293 1..293
PplHalPrx02 456 2e-164 1..279 1..280
PcarHalPrx01 378 4e-133 4..282 5..284
PcHalPrx01 369 1e-129 4..283 5..285
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 82882..83143 262 N° 2 82622..82825 204 N° 3 82349..82547 199 N° 4 82059..82284 226
complement(join(82059..82284,82349..82547,82622..82825,82882..83143))


exon

Literature and cross-references PplHalPrx01
DNA ref. JGI genome:   scaffold_116 (83143..82059)
mRNA ref. JGI transcript:   61079
Protein sequence: PplHalPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   296
PWM (Da):   %s   31571.44 Transmb domain:   %s   i12-34o
PI (pH):   %s   7.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPPFIIIASTRLTVGLISSLLNILTNLGVVVWDLGLTLFNLVAPLRPADRVVPAGCPGAGGRWPEYIPPKEGDSRSACPGLNALANHGLLPRSGRNISFRQMNAAIRSTFNFAPTFCFFVPSYMAGLLGKSYWTDTLDLSDISVHNGIEHDASLTREDTSESPHQGEPCERFINELLASGTGPGGNLTVADLSRISGKRRTEAKSNGQFTLSAFHKLFGSSNSGTLLTIFGGRVQDLRPILLEERIPEGWQPRIRNPAGLTLTAFQPTVLGIELGIEEEVAGALKVLGVGSTSKAS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCCCTTCATCATCATCGCATCGACACGCCTGACCGTCGGGCTCATCTCGAGTCTGCTCAACATCCTGACGAACCTCGGCGTCGTGGTATGGGATCTAGGGCTAACATTGTTCAAC
CTGGTGGCACCGCTGCGACCTGCAGACCGTGTCGTGCCTGCGGGCTGCCCCGGCGCGGGCGGACGCTGGCCCGAATACATCCCGCCCAAGGAGGGCGACAGCCGGAGCGCATGTCCGGGC
CTGAATGCACTCGCCAACCACG
GTGCGATCACATCATGTCGATCCTGCCGCAGGCAGGCACGAGCTGATTCCGTACAGGCCTGCTCCCCCGCTCCGGGCGCAACATCTCGTTCCGCCAGA
TGAACGCGGCCATCCGTTCGACGTTCAACTTCGCGCCCACGTTCTGCTTCTTCGTGCCAAGTTACATGGCCGGCCTGCTCGGCAAGAGCTACTGGACCGACACGCTCGACTTGAGTGACA
TCAGCGTGCACAACGGCATCGAGCACGATGCGTCTCTCACTC
GTACGCACCCTCACTTGTCACATAGGCTCAAAATAGGAGCTGACCATACATCCGAAATTACACCGCCCCCGCAGGCGA
AGACACGTCTGAGTCGCCTCACCAAGGAGAACCCTGCGAGCGCTTCATCAACGAGCTCCTCGCCTCGGGGACAGGCCCAGGCGGGAACCTCACCGTGGCCGACCTGTCACGTATATCGGG
TAAACGGCGTACAGAAGCGAAGTCGAATGGACAGTTCACGCTCTCCGCGTTCCACAAACTCTTCGGGAGTTCCAA
GTAAGGCATCACGTTCCTGTGGTTTTGTTCAGCCGGGACGTACTC
ATATCTCGGGCGTCCGCAGCTCGGGCACCCTCCTCACAATCTTCGGCGGCAGGGTGCAAGACCTTCGTCCCATATTACTGGAGGAGCGCATACCTGAAGGCTGGCAGCCGCGCATTCGAA
ATCCAGCCGGCCTCACATTGACCGCATTCCAACCGACAGTGTTAGGCATAGAACTAGGAATCGAAGAGGAGGTTGCTGGCGCGCTGAAAGTGCTAGGTGTCGGCAGCACCAGCAAGGCAT
CTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCCCTTCATCATCATCGCATCGACACGCCTGACCGTCGGGCTCATCTCGAGTCTGCTCAACATCCTGACGAACCTCGGCGTCGTGGTATGGGATCTAGGGCTAACATTGTTCAAC
CTGGTGGCACCGCTGCGACCTGCAGACCGTGTCGTGCCTGCGGGCTGCCCCGGCGCGGGCGGACGCTGGCCCGAATACATCCCGCCCAAGGAGGGCGACAGCCGGAGCGCATGTCCGGGC
CTGAATGCACTCGCCAACCACG
GCCTGCTCCCCCGCTCCGGGCGCAACATCTCGTTCCGCCAGATGAACGCGGCCATCCGTTCGACGTTCAACTTCGCGCCCACGTTCTGCTTCTTCGTG
CCAAGTTACATGGCCGGCCTGCTCGGCAAGAGCTACTGGACCGACACGCTCGACTTGAGTGACATCAGCGTGCACAACGGCATCGAGCACGATGCGTCTCTCACTC
GCGAAGACACGTCT
GAGTCGCCTCACCAAGGAGAACCCTGCGAGCGCTTCATCAACGAGCTCCTCGCCTCGGGGACAGGCCCAGGCGGGAACCTCACCGTGGCCGACCTGTCACGTATATCGGGTAAACGGCGT
ACAGAAGCGAAGTCGAATGGACAGTTCACGCTCTCCGCGTTCCACAAACTCTTCGGGAGTTCCAA
CTCGGGCACCCTCCTCACAATCTTCGGCGGCAGGGTGCAAGACCTTCGTCCCATA
TTACTGGAGGAGCGCATACCTGAAGGCTGGCAGCCGCGCATTCGAAATCCAGCCGGCCTCACATTGACCGCATTCCAACCGACAGTGTTAGGCATAGAACTAGGAATCGAAGAGGAGGTT
GCTGGCGCGCTGAAAGTGCTAGGTGTCGGCAGCACCAGCAAGGCATCTTGA

Retrieve as FASTA