Entry information : PplHalPrx02
Entry ID 6730
Creation 2009-04-30 (Christophe Dunand)
Last sequence changes 2009-04-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-17 (Catherine Mathe (Scipio))
Peroxidase information: PplHalPrx02
Name PplHalPrx02
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplHalPrx02
start..stop
S start..stop
PplHalPrx01 456 2e-164 1..280 1..279
PplHalPrx03 454 2e-163 1..277 1..276
PcarHalPrx01 372 5e-131 4..280 6..281
PcHalPrx01 370 2e-130 2..280 3..281
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 50482..50743 262 N° 2 50222..50425 204 N° 3 49951..50152 202 N° 4 49716..49890 175
complement(join(49716..49890,49951..50152,50222..50425,50482..50743))


exon

Literature and cross-references PplHalPrx02
DNA ref. JGI genome:   scaffold_146 (50743..49716)
mRNA ref. JGI transcript:   62911
Protein sequence: PplHalPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   280
PWM (Da):   %s   30680.78 Transmb domain:   %s   i12-34o
PI (pH):   %s   7.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFILIASRRITLGILSSLLNVLTNLGVVVWDLGLTLFNLLAPLRPANRVVPEGHPGAGGRWPEYIAPKEGDSRSACPALNAMANHGILPRSGRNISFREMNTAIRSTYNYSPTFCFFVPNYMAGLLGKSYWNDTLDLEDISVHNGIEHDASLTREDTYIEPDQGKPCERLITELLASGTGPGGDITPADLSRAQGKRRVEAMKTNGQFTLSTFHKLFGSTNASNLLATFDGKVDDLRPFLLEERIPEGWQSRIRYSKGLTITSFQSTILRVELGIAEK

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Also found in scaffold_92 (5845..6854).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCATTCATCCTCATCGCGTCAAGGCGCATAACCCTGGGGATACTATCGAGCTTGCTGAATGTCCTGACGAATCTCGGTGTCGTGGTGTGGGACTTGGGCTTGACCTTGTTCAAT
CTACTAGCACCACTTAGACCAGCAAACCGTGTCGTGCCCGAAGGCCACCCAGGCGCAGGCGGGCGTTGGCCGGAGTACATTGCACCTAAAGAGGGTGATAGCAGGAGTGCGTGTCCTGCG
TTGAACGCAATGGCGAATCATG
GTAGAGTTCAGTGCCCCTCAGCTCGAGATAGTCATAACCCAGCGTTACCCCGGCAGGCATTCTCCCTCGGTCAGGACGTAACATATCCTTCCGCGAGA
TGAACACGGCCATCCGTTCGACATACAACTACTCGCCGACTTTCTGCTTTTTTGTCCCGAACTACATGGCTGGGTTGCTCGGTAAGAGCTATTGGAATGACACGCTCGACCTAGAGGACA
TCAGCGTACATAATGGAATTGAACATGACGCTTCCTTGACAC
GTTCGTACCCCATGCATAGGTCTCATGAGCAGCACGCTAATTGCTTTATCAACCTATTGTGCCCTATAGGTGAAGATA
CCTATATTGAACCTGACCAAGGAAAGCCTTGCGAGCGTCTCATTACGGAGCTCCTTGCTTCTGGAACAGGTCCGGGGGGTGATATTACCCCTGCCGATCTGTCCCGAGCTCAAGGTAAAC
GACGTGTAGAGGCCATGAAGACTAACGGCCAATTCACGCTTTCAACCTTCCACAAGCTTTTTGGAAGCACGAA
GTAGGAGAACATTCTTGTCAGATATCCTAACATTATGCTGATCTGTA
AACTTATCGCTAGTGCGTCAAATCTGCTAGCAACATTCGATGGAAAAGTGGATGACCTCCGACCTTTCTTGCTTGAGGAACGCATCCCGGAGGGCTGGCAGTCACGCATACGGTATTCAA
AAGGCCTCACAATTACCTCATTCCAGAGTACGATACTGAGGGTGGAATTAGGGATCGCGGAAAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCATTCATCCTCATCGCGTCAAGGCGCATAACCCTGGGGATACTATCGAGCTTGCTGAATGTCCTGACGAATCTCGGTGTCGTGGTGTGGGACTTGGGCTTGACCTTGTTCAAT
CTACTAGCACCACTTAGACCAGCAAACCGTGTCGTGCCCGAAGGCCACCCAGGCGCAGGCGGGCGTTGGCCGGAGTACATTGCACCTAAAGAGGGTGATAGCAGGAGTGCGTGTCCTGCG
TTGAACGCAATGGCGAATCATG
GCATTCTCCCTCGGTCAGGACGTAACATATCCTTCCGCGAGATGAACACGGCCATCCGTTCGACATACAACTACTCGCCGACTTTCTGCTTTTTTGTC
CCGAACTACATGGCTGGGTTGCTCGGTAAGAGCTATTGGAATGACACGCTCGACCTAGAGGACATCAGCGTACATAATGGAATTGAACATGACGCTTCCTTGACAC
GTGAAGATACCTAT
ATTGAACCTGACCAAGGAAAGCCTTGCGAGCGTCTCATTACGGAGCTCCTTGCTTCTGGAACAGGTCCGGGGGGTGATATTACCCCTGCCGATCTGTCCCGAGCTCAAGGTAAACGACGT
GTAGAGGCCATGAAGACTAACGGCCAATTCACGCTTTCAACCTTCCACAAGCTTTTTGGAAGCACGAA
TGCGTCAAATCTGCTAGCAACATTCGATGGAAAAGTGGATGACCTCCGACCT
TTCTTGCTTGAGGAACGCATCCCGGAGGGCTGGCAGTCACGCATACGGTATTCAAAAGGCCTCACAATTACCTCATTCCAGAGTACGATACTGAGGGTGGAATTAGGGATCGCGGAAAAG
TGA

Retrieve as FASTA