Entry information : PplHalPrx03
Entry ID 6731
Creation 2009-04-30 (Christophe Dunand)
Last sequence changes 2012-04-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-17 (Catherine Mathe (Scipio))
Peroxidase information: PplHalPrx03
Name PplHalPrx03
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplHalPrx03
start..stop
S start..stop
PplHalPrx01 578 0 1..293 1..293
PplHalPrx02 454 2e-163 1..276 1..277
PcarHalPrx01 378 5e-133 4..282 5..284
PcHalPrx01 367 1e-128 4..283 5..285
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 96640..96901 262 N° 2 96958..97161 204 N° 3 97240..97438 199 N° 4 97504..97735 232
join(96640..96901,96958..97161,97240..97438,97504..97735)


exon

Literature and cross-references PplHalPrx03
DNA ref. JGI genome:   scaffold_131 (96640..97735)
mRNA ref. JGI transcript:   25391 [3' end]
Protein sequence: PplHalPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   298
PWM (Da):   %s   31855.6 Transmb domain:   %s   i12-34o
PI (pH):   %s   7.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPPFIIIASTRLTVGLISSLLNVLTNLGVVVWDLGLTLFNLVAPLRPADRVVPEGCPGAGGRWPEYIPPKEGDSRSACPGLNALANHGLLPRSGRNISFRQMNAAIRSTFNFAPTFCFFVPSYMAGVLGKSYWTDTLDLSDISVHNGIEHDASLTREDTSESPHQGEPCERFINELLASGTGPGGNLTVADLSRISGKRRIEAKRNGQFTLSAFHKLFGSSNSGTLLTIFGGRVQDLRPILLEERLPEGWQPRIRNPGGLTLTAFQPTVLGIELGIEAEVAGALKALGVGSTSDKKTS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCCCTTCATCATCATCGCATCGACACGCCTGACCGTTGGGCTCATCTCGAGTCTGCTCAACGTCCTGACGAACCTCGGCGTCGTGGTATGGGATCTGGGGCTGACATTATTCAAC
CTCGTGGCACCGCTGCGACCCGCAGACCGTGTCGTGCCTGAGGGCTGCCCCGGCGCGGGCGGACGCTGGCCCGAATACATCCCGCCCAAGGAGGGCGACAGCCGGAGCGCATGTCCGGGG
CTGAATGCACTCGCTAACCACG
GTGCGATCACATCATGTCGATCCCGCCGCAGGCAGGCACGAGCTGATCCCGTACAGGCCTGCTCCCCCGCTCCGGGCGTAATATCTCGTTCCGCCAGA
TGAACGCGGCCATCCGTTCGACGTTCAACTTCGCGCCCACGTTCTGCTTCTTCGTGCCAAGTTATATGGCCGGCGTGCTCGGCAAGAGCTACTGGACCGACACGCTCGACCTGAGTGACA
TCAGCGTGCACAACGGCATCGAGCACGATGCGTCTCTCACTC
GTACGCACCCTCACTTGTCACATACCTCAAGATAGGAGCTGACCATACATCCGAAATTACACCGCCCGCGCCCCGCAG

GCGAAGACACGTCTGAGTCGCCTCACCAAGGAGAACCCTGCGAGCGCTTCATCAACGAGCTCCTCGCCTCGGGGACAGGCCCAGGCGGGAACCTCACTGTGGCCGATCTGTCGCGCATAT
CGGGTAAACGGCGTATAGAAGCGAAAAGAAATGGACAGTTCACGCTCTCCGCGTTCCACAAACTCTTCGGGAGCTCCAA
GTAAGGCATCACGTTCCTACGGGGTTCGTTCAGCCGGGACG
TACTTATATCTCGGGCGTCCGCAGCTCGGGCACCCTCCTCACAATCTTCGGCGGCAGGGTGCAAGATCTTCGTCCCATACTGCTCGAAGAGCGCCTACCTGAAGGCTGGCAGCCACGCAT
CCGAAACCCAGGCGGCCTCACATTGACCGCATTCCAACCAACAGTGCTAGGCATAGAACTAGGAATCGAAGCGGAGGTCGCTGGCGCGTTGAAAGCGCTGGGTGTCGGCAGCACCAGCGA
TAAGAAGACATCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCCCCTTCATCATCATCGCATCGACACGCCTGACCGTTGGGCTCATCTCGAGTCTGCTCAACGTCCTGACGAACCTCGGCGTCGTGGTATGGGATCTGGGGCTGACATTATTCAAC
CTCGTGGCACCGCTGCGACCCGCAGACCGTGTCGTGCCTGAGGGCTGCCCCGGCGCGGGCGGACGCTGGCCCGAATACATCCCGCCCAAGGAGGGCGACAGCCGGAGCGCATGTCCGGGG
CTGAATGCACTCGCTAACCACG
GCCTGCTCCCCCGCTCCGGGCGTAATATCTCGTTCCGCCAGATGAACGCGGCCATCCGTTCGACGTTCAACTTCGCGCCCACGTTCTGCTTCTTCGTG
CCAAGTTATATGGCCGGCGTGCTCGGCAAGAGCTACTGGACCGACACGCTCGACCTGAGTGACATCAGCGTGCACAACGGCATCGAGCACGATGCGTCTCTCACTC
GCGAAGACACGTCT
GAGTCGCCTCACCAAGGAGAACCCTGCGAGCGCTTCATCAACGAGCTCCTCGCCTCGGGGACAGGCCCAGGCGGGAACCTCACTGTGGCCGATCTGTCGCGCATATCGGGTAAACGGCGT
ATAGAAGCGAAAAGAAATGGACAGTTCACGCTCTCCGCGTTCCACAAACTCTTCGGGAGCTCCAA
CTCGGGCACCCTCCTCACAATCTTCGGCGGCAGGGTGCAAGATCTTCGTCCCATA
CTGCTCGAAGAGCGCCTACCTGAAGGCTGGCAGCCACGCATCCGAAACCCAGGCGGCCTCACATTGACCGCATTCCAACCAACAGTGCTAGGCATAGAACTAGGAATCGAAGCGGAGGTC
GCTGGCGCGTTGAAAGCGCTGGGTGTCGGCAGCACCAGCGATAAGAAGACATCTTGA

Retrieve as FASTA