Entry information : PplCIIBA
Entry ID 6737
Creation 2009-05-25 (Christophe Dunand)
Last sequence changes 2012-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-04-30 (Christophe Dunand)
Peroxidase information: PplCIIBA
Name PplCIIBA
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplCIIBA
start..stop
S start..stop
LsulCIIBA01 416 8e-147 4..311 33..342
WcoCIIBA 407 8e-144 8..306 23..323
FpinCIIBA 382 8e-134 12..285 47..320
DqueCIIBB01 365 5e-128 18..280 2..264
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1051323..1051387 65 N° 2 1051157..1051261 105 N° 3 1051089..1051102 14 N° 4 1050997..1051038 42
N° 5 1050863..1050941 79 N° 6 1050494..1050788 295 N° 7 1050292..1050436 145 N° 8 1050057..1050223 167
N° 9 1049946..1049996 51  
complement(join(1049946..1049996,1050057..1050223,1050292..1050436,1050494..1050 788,1050863..1050941,1050997..1051038,1051089..1051102,1051157..1051261,1051323. .1051387))


exon

Literature and cross-references PplCIIBA
DNA ref. JGI genome:   scaffold_1 (1051387..1049946)
mRNA ref. JGI transcript:   50226 [3' end]
Protein sequence: PplCIIBA
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320
PWM (Da):   %s   33774.66  
PI (pH):   %s   5.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYTSSCLPNCSLQIREELQANFFGKGHCKGPAREAIRLTFHDGIGRSATLAASGTFGGGGDGSIIKFADSELADPANDGLEDIVYALKSFADNHGVSYGDIIQFAGAVALSNCPGSPRLAFYAGRPQAIAPSPPGLIPSPTDSVKDILARMSDAGFTPDDTVALLAAHSVAVQNTVDPTIPDTPLDSTPELFDTQFYLTLLRGTTYPGTGRNTAGVKSPSKHLFRLASDAAIARDARTACRWQSFAHDQEALRTSFRNAMLKLANQGFEGLINCSFIIPESLPHWKAATFPYGTNASDIEHCPSNSSPEGVIPDVSR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns). No EST. Incorrect prediction from JGI. Prob of splicing prediction of the PS when compared with orther orthologs. Also detected in scafold_58 (mismatchs but gene identity between the 2 scaffolds).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACGAGTTCTTGCCTTCCAAACTGTTCACTCCAAATTCGGGAAGAATTACAAGCAAATTTGTGGGCGCCATCCAAGCGCTTTATCGCGACTATTGTCAAAATCTTACACATGACT
CCGCAGCTTTGGCAAAGGGCACTGTAAAGGACCCGCACGAGAGGCAATTCGACTGACCTTCCATGACGGCATCGGCCGGTCTGCCACATTGGCAGCTTCTGGTACTTTTGGGTACGACTT
TTCTCAATTCCAAGCTGTTTACGTTTGATAGGCGATTGTACGTAGCGGAGGCGGGGCAGGTAGGCCTGCATGTCATCACCAGCGATACAATGGACTCATATCAGGAAAGACGGCAGCATA
ATCAAGTTCGCGGACTCTGAACTTGCAGACC
GTGAGATGCACATGTCCCCTAACTCGGCTCCTTGACAGCTGTTCTGATACTGCAGCCGCGAATGACGGACTGGAAGACATAGTCTACGC
CCTGAAATCCTTCGCCGACAACCACGGAGTAAGCTACGGAGACAT
GTAAGGACACGCCGTTCTGTCCTCTTCCCACGGCTTTCCTCGATACTTGTTCCGCATCGCTGACGTCATCCAAGT
ATCCAATTCGCCGGAGCTGTGGCCCTCTCGAATTGCCCTGGGAGTCCTCGCCTTGCATTCTACGCTGGACGTCCTCAGGCTATCGCTCCGTCTCCGCCCGGCCTTATTCCGTCACCCACG
GACTCTGTCAAAGATATCTTAGCCCGGATGTCTGATGCTGGATTCACACCCGATGACACCGTAGCGCTTTTGGCCGCTCATTCCGTTGCTGTACAGAACACTGTCGACCCCACCATCCCT
GATACTCCCCTCGATTCGACCCCTGAACTCTTTGACACGCAGTTCTATCTGGAG
GTATGTCTGGGAATGTGGTCTGCCTGGCGCTATTTTGTAACGTTTCGGCGGCGAAAGACGCTGCTG
AGGGGAACAACTTATCCCGGAACAGGAAGAAACACGGCAGGGGTCAAGTCGCCGTCCAAGCACCTGTTTCGGCTTGCGTCCGACGCGGCAATAGCTCGTGATGCCCGCACAGCATGCAGG
TGGCAGTCTTTCGCTC
GTGAGTGTGCCTCAAGGCGGTGCTCAGAACACGGCTTTACAAGCGCCCCTGGCGCTTCATGACATCAGACGATCAGGAAGCGCTGCGGACCTCGTTCCGGAATG
CAATGTTGAAGCTGGCAAATCAAGGATTCGAAGGCCTCATTAACTGCTCTTTCATCATCCCTGAATCGCTTCCACATTGGAAAGCTGCGACATTCCCTTATGGAACAAACGCATCTGATA
TCGAACACTCA
GTAAGTCGCGCCTACTTCCAAAAAATTCATTTGCAATCTAATCCCCGCGGTATATATCAGTGTCCGAGCAACTCCTCCCCGGAGGGCGTTATTCCGGACGTATCGAGAT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACGAGTTCTTGCCTTCCAAACTGTTCACTCCAAATTCGGGAAGAATTACAAGCAAATTTCTTTGGCAAAGGGCACTGTAAAGGACCCGCACGAGAGGCAATTCGACTGACCTTC
CATGACGGCATCGGCCGGTCTGCCACATTGGCAGCTTCTGGTACTTTTGG
CGGAGGCGGGGCAGACGGCAGCATAATCAAGTTCGCGGACTCTGAACTTGCAGACCCCGCGAATGACGGA
CTGGAAGACATAGTCTACGCCCTGAAATCCTTCGCCGACAACCACGGAGTAAGCTACGGAGACAT
TATCCAATTCGCCGGAGCTGTGGCCCTCTCGAATTGCCCTGGGAGTCCTCGCCTT
GCATTCTACGCTGGACGTCCTCAGGCTATCGCTCCGTCTCCGCCCGGCCTTATTCCGTCACCCACGGACTCTGTCAAAGATATCTTAGCCCGGATGTCTGATGCTGGATTCACACCCGAT
GACACCGTAGCGCTTTTGGCCGCTCATTCCGTTGCTGTACAGAACACTGTCGACCCCACCATCCCTGATACTCCCCTCGATTCGACCCCTGAACTCTTTGACACGCAGTTCTATCTGGAG
ACGCTGCTGAGGGGAACAACTTATCCCGGAACAGGAAGAAACACGGCAGGGGTCAAGTCGCCGTCCAAGCACCTGTTTCGGCTTGCGTCCGACGCGGCAATAGCTCGTGATGCCCGCACA
GCATGCAGGTGGCAGTCTTTCGCTC
ACGATCAGGAAGCGCTGCGGACCTCGTTCCGGAATGCAATGTTGAAGCTGGCAAATCAAGGATTCGAAGGCCTCATTAACTGCTCTTTCATCATC
CCTGAATCGCTTCCACATTGGAAAGCTGCGACATTCCCTTATGGAACAAACGCATCTGATATCGAACACTCA
TGTCCGAGCAACTCCTCCCCGGAGGGCGTTATTCCGGACGTATCGAGA
TAA

Retrieve as FASTA