Entry information : PplNOx01-1A (PplNOx01a)
Entry ID 6750
Creation 2009-05-04 (Christophe Dunand)
Last sequence changes 2009-05-04 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-19 (Catherine Mathe)
Peroxidase information: PplNOx01-1A (PplNOx01a)
Name (synonym) PplNOx01-1A (PplNOx01a)
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplNOx01-1A
start..stop
S start..stop
PplNOx01-1B 1155 0 1..557 1..557
PcarNOx01 986 0 1..557 1..559
PcNOx01 978 0 1..557 1..559
LbiNOx01 947 0 1..557 1..559
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 423035..423145 111 N° 2 422711..422981 271 N° 3 422270..422659 390 N° 4 422111..422211 101
N° 5 421741..422041 301 N° 6 421522..421686 165 N° 7 421241..421470 230 N° 8 421092..421184 93
N° 9 421027..421038 12  
complement(join(421027..421038,421092..421184,421241..421470,421522..421686,4217 41..422041,422111..422211,422270..422659,422711..422981,423035..423145))


exon

Literature and cross-references PplNOx01-1A (PplNOx01a)
DNA ref. JGI genome:   scaffold_48 (423145..421027)
mRNA ref. JGI transcript:   109236
Protein sequence: PplNOx01-1A (PplNOx01a)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   557
PWM (Da):   %s   63576.36 Transmb domain:   %s   i16-38o53-75i103-122o137-159i172-191o
PI (pH):   %s   8.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGESWFRREFLAPRRLIFNVLFFGLQVSFFSYGWWAQATNNKLAALNALQWSVWVSRGAGLVLAFLAACLLLPMLRNCIRVIRPKVAFLFPADENIWFHRQAAYCLAFWSMVHTTAHYVNFINVERTQVRQEYALQIHYTQAGGITGHFMLLCMVLMYTTAHHKVRQQCFEAFWYTHHLAFFFFIALWTHADGCFVRDSTNAAYIDTFPFYNAEFCLGYESWRFTIWPGIIYFGERVWREVRARRATRLSKVLVHPSGAMELRIVKPSFKYVAGQWLFIQVPEVSKFQWHFTITSAPEDPYVSVHIRQVGDFTQALGDRVGAGPSVVAAMTKAAMIGSEKDDSVYGTRGDFVELDSGARPLPTVRIDGPYGAPAEDVFNVEVAVLVGAGIGVTPFASILKHIWYRQKKGNLQSLKRVEFFWVCRDAPSFGWFQTLLQEVEEAQVDPNFLRINIYLTQKIGEDMLWNIALNDAGAEYDPLTLLRTRTMFGRPDWKNIYARMKQAIEMGQYLPGTKEQLKTKVTYFCGPGVMAKAIKEACVASTTPNINFTFAKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and 41 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAAAGCTGGTTCCGTCGCGAGTTCCTCGCTCCCCGAAGGCTCATATTCAACGTCCTGTTCTTTGGCCTCCAGGTCTCCTTCTTCTCATATGGATGGTGGGCGCAGGTATGCCGA
TTTACTACCTTATCTGTGCGAGTGAACTCTTAACCTCGCTGCAGGCAACGAATAACAAACTAGCTGCTCTCAATGCCCTGCAATGGTCTGTCTGGGTATCTCGCGGTGCTGGTCTCGTCT
TGGCCTTCCTCGCCGCCTGTCTGCTTCTTCCCATGCTGCGTAACTGCATCCGAGTCATCCGTCCTAAAGTCGCCTTCCTCTTCCCTGCCGATGAAAACATTTGGTTCCATCGCCAAGCAG
CATACTGTCTCGCTTTCTGGTCCATGGTTCACACCACCGCTCATTATGTGAACTTCATCAATGTCGAGCGAACCC
GTATGTGACACTTGGTTGATTGCCTCTTGCGTAGGCTAAAGCGGT
CTGTAGAGGTCCGCCAGGAGTATGCTTTACAAATCCATTACACGCAGGCCGGTGGTATCACGGGGCACTTCATGCTGCTCTGCATGGTTCTCATGTACACCACCGCTCATCACAAGGTCC
GCCAGCAGTGTTTCGAAGCATTCTGGTACACGCATCACCTGGCCTTCTTCTTCTTCATCGCTCTCTGGACCCATGCCGATGGTTGCTTCGTCCGGGATAGCACAAATGCAGCGTACATCG
ATACGTTTCCCTTCTATAACGCAGAGTTCTGCCTCGGTTATGAGAGTTGGCGTTTCACTATTTGGCCGGGAATCATTTATTTCGGAGAGCGCGTTTGGAGGGAGGTCAGGGCGAGGCGTG
CTACCAGACTGTCTAAGGTCCTCGTTCATCCTAGTG
GTAAGCGATTATTGTTTACTCTTCGGCGTGATGGTGTCTCTATCTCACATCATATCAGGGGCGATGGAACTCAGAATTGTCAAG
CCGAGCTTCAAGTATGTCGCGGGACAGTGGCTCTTCATTCAGGTCCCAGAGGTCTCCAAGTTTCAATGGCATCCG
GTACGGTCGAATTATGTCCTTGATGCCACGCTGCTAGCTGACTGT
CTGCTTGTCATGATGTTTTTATAGTTCACGATCACTTCGGCCCCCGAGGATCCTTACGTCTCCGTTCATATCAGGCAGGTCGGTGACTTCACGCAGGCACTTGGTGACCGCGTGGGTGCG
GGGCCGTCTGTTGTCGCTGCTATGACGAAGGCTGCCATGATAGGCTCTGAGAAGGATGATTCCGTCTATGGGACGCGTGGCGACTTCGTGGAACTTGATTCAGGTGCTCGTCCTCTGCCA
ACAGTGCGGATCGACGGACCGTACGGCGCCCCGGCCGAAGACGTGTTCAACGTCGAAGTAGCTGTTCTGGTCGGTGCCGGTATTG
GTAAGACTCTATTGTGCTGCCATTTCTCTCAGACA
TGCTAAGATCTCTTCACAGGTGTTACACCGTTTGCGTCTATCTTGAAGCATATATGGTACCGTCAGAAGAAGGGCAATCTTCAATCTTTGAAGCGGGTCGAGTTCTTTTGGGTCTGCCGT
GATGCGCCGTCCTTCGGCTGGTTCCAGACCCTCCTGCAGGAGGTCGAGGAGGCCCAAGTTGATC
GTGGGTAGCCCATTCGTAGCAAAATAGAGCGCAACTAACGACTCTGTGTAGCCAAC
TTCTTGCGCATCAACATCTATCTTACCCAGAAGATCGGCGAGGATATGCTATGGAACATCGCCCTTAACGACGCAGGCGCTGAGTATGACCCCCTCACTCTGCTTCGCACTCGTACGATG
TTCGGTCGTCCGGACTGGAAGAATATCTACGCCCGCATGAAGCAGGCTATCGAAATGGGTCAGTACCTCCCTGGTACTAAGGAGCAACTCAAGACGAAAGTTGGC
GTGAGTATACTTCGA
AATGGTTTCCATAGAGTCGTGAATGCTGAACTCTAAGAAAGACGTACTTCTGCGGACCTGGCGTCATGGCAAAGGCCATCAAAGAGGCCTGCGTGGCTTCGACAACTCCCAACATCAACT
TCACTTTCGCTAAG
GTTTGTCCTGCTTTGCCACATTCTGTGCGACTACTTACATGTGCGCCATGCAGGAGCACTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAAAGCTGGTTCCGTCGCGAGTTCCTCGCTCCCCGAAGGCTCATATTCAACGTCCTGTTCTTTGGCCTCCAGGTCTCCTTCTTCTCATATGGATGGTGGGCGCAGGCAACGAAT
AACAAACTAGCTGCTCTCAATGCCCTGCAATGGTCTGTCTGGGTATCTCGCGGTGCTGGTCTCGTCTTGGCCTTCCTCGCCGCCTGTCTGCTTCTTCCCATGCTGCGTAACTGCATCCGA
GTCATCCGTCCTAAAGTCGCCTTCCTCTTCCCTGCCGATGAAAACATTTGGTTCCATCGCCAAGCAGCATACTGTCTCGCTTTCTGGTCCATGGTTCACACCACCGCTCATTATGTGAAC
TTCATCAATGTCGAGCGAACCC
AGGTCCGCCAGGAGTATGCTTTACAAATCCATTACACGCAGGCCGGTGGTATCACGGGGCACTTCATGCTGCTCTGCATGGTTCTCATGTACACCACC
GCTCATCACAAGGTCCGCCAGCAGTGTTTCGAAGCATTCTGGTACACGCATCACCTGGCCTTCTTCTTCTTCATCGCTCTCTGGACCCATGCCGATGGTTGCTTCGTCCGGGATAGCACA
AATGCAGCGTACATCGATACGTTTCCCTTCTATAACGCAGAGTTCTGCCTCGGTTATGAGAGTTGGCGTTTCACTATTTGGCCGGGAATCATTTATTTCGGAGAGCGCGTTTGGAGGGAG
GTCAGGGCGAGGCGTGCTACCAGACTGTCTAAGGTCCTCGTTCATCCTAGTG
GGGCGATGGAACTCAGAATTGTCAAGCCGAGCTTCAAGTATGTCGCGGGACAGTGGCTCTTCATTCAG
GTCCCAGAGGTCTCCAAGTTTCAATGGCATCCG
TTCACGATCACTTCGGCCCCCGAGGATCCTTACGTCTCCGTTCATATCAGGCAGGTCGGTGACTTCACGCAGGCACTTGGTGACCGC
GTGGGTGCGGGGCCGTCTGTTGTCGCTGCTATGACGAAGGCTGCCATGATAGGCTCTGAGAAGGATGATTCCGTCTATGGGACGCGTGGCGACTTCGTGGAACTTGATTCAGGTGCTCGT
CCTCTGCCAACAGTGCGGATCGACGGACCGTACGGCGCCCCGGCCGAAGACGTGTTCAACGTCGAAGTAGCTGTTCTGGTCGGTGCCGGTATTG
GTGTTACACCGTTTGCGTCTATCTTG
AAGCATATATGGTACCGTCAGAAGAAGGGCAATCTTCAATCTTTGAAGCGGGTCGAGTTCTTTTGGGTCTGCCGTGATGCGCCGTCCTTCGGCTGGTTCCAGACCCTCCTGCAGGAGGTC
GAGGAGGCCCAAGTTGATC
CCAACTTCTTGCGCATCAACATCTATCTTACCCAGAAGATCGGCGAGGATATGCTATGGAACATCGCCCTTAACGACGCAGGCGCTGAGTATGACCCCCTC
ACTCTGCTTCGCACTCGTACGATGTTCGGTCGTCCGGACTGGAAGAATATCTACGCCCGCATGAAGCAGGCTATCGAAATGGGTCAGTACCTCCCTGGTACTAAGGAGCAACTCAAGACG
AAAGTTGGC
ACGTACTTCTGCGGACCTGGCGTCATGGCAAAGGCCATCAAAGAGGCCTGCGTGGCTTCGACAACTCCCAACATCAACTTCACTTTCGCTAAGGAGCACTTTTGA

Retrieve as FASTA