Entry information : PplNOx01-1B (PplNOx01b)
Entry ID 6751
Creation 2009-05-04 (Christophe Dunand)
Last sequence changes 2009-05-04 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-04-19 (Catherine Mathe)
Peroxidase information: PplNOx01-1B (PplNOx01b)
Name (synonym) PplNOx01-1B (PplNOx01b)
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplNOx01-1B
start..stop
S start..stop
PplNOx01-1A 1155 0 1..557 1..557
PcarNOx01 989 0 1..557 1..559
PcNOx01 981 0 1..557 1..559
LbiNOx01 946 0 1..557 1..559
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 443518..443628 111 N° 2 443194..443464 271 N° 3 442753..443142 390 N° 4 442594..442694 101
N° 5 442224..442524 301 N° 6 442005..442169 165 N° 7 441726..441955 230 N° 8 441577..441669 93
N° 9 441512..441523 12  
complement(join(441512..441523,441577..441669,441726..441955,442005..442169,4422 24..442524,442594..442694,442753..443142,443194..443464,443518..443628))


exon

Literature and cross-references PplNOx01-1B (PplNOx01b)
DNA ref. JGI genome:   scaffold_26 (443628..441512)
mRNA ref. JGI transcript:   109097
Protein sequence: PplNOx01-1B (PplNOx01b)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   557
PWM (Da):   %s   63619.41 Transmb domain:   %s   i16-38o53-75i103-122o137-159i172-191o
PI (pH):   %s   9.09
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGESWFRREFLNPRRLIFNVLFFGLQVSFFSYGWWAQATNKKLAALNALQWSVWVSRGAGLVLAFLAACLLLPMLRNCIRVIRPKVAFLFPADENIWFHRQAAYCLAFWSMVHTTAHYVNFINVERTQVRQEYALQIHYTQAGGITGHFMLLCMVLMYTTAHHKVRQQCFEAFWYTHHLAFFFFIALWTHADGCFVRDSTNAAYIDSFPFYNAEFCLGYESWRFTIWPGIIYFGERVWREVRARRATRLSKVLVHPSGAMELRIVKPSFKYVAGQWLFIQVPEVSKFQWHFTITSAPEDPYVSVHIRQVGDFTQALGDRVGAGPSVVAAMTKAAMIGSEKDDSVYGTRGDFVELDSGARPLPTVRIDGPYGAPAEDVFNVEVAVLVGAGIGVTPFASILKHIWYRQKKGNLQSLKRVEFFWVCRDAPSFGWFQTLLQEVEEAQVDPNFLRINIYLTQKIGEDMLWNIALNDAGAEYDPLTLLRTRTMFGRPDWKNIYARMKQAIEMGQYLPGTKEQLKTKVTYFCGPGVMAKAIKEACVASTTPNINFTFAKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic and EST. Differed from several aa from PplNOx01 (ESt to confirme).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAAAGCTGGTTCCGTCGCGAGTTCCTCAATCCCCGAAGGCTCATATTCAACGTCTTGTTCTTTGGCCTCCAGGTCTCGTTCTTCTCATATGGATGGTGGGCACAGGTATGTCGA
TTTACTACCTTGTCCGTGCGAGTGGACACTTAACCTCGCTGCAGGCAACCAATAAGAAACTAGCTGCTCTCAATGCCCTGCAATGGTCTGTCTGGGTATCTCGTGGTGCTGGTCTCGTGT
TGGCCTTCCTCGCCGCCTGTCTCCTTCTTCCTATGCTGCGCAACTGCATCCGAGTCATCCGTCCCAAAGTCGCCTTCCTCTTCCCAGCTGATGAAAACATTTGGTTCCATCGCCAAGCAG
CATACTGTCTCGCTTTCTGGTCCATGGTTCACACCACCGCTCATTATGTGAACTTCATCAATGTCGAGCGAACCC
GTATGTGACGCTTGGTTAATTGCCTCTAGCGTAGGCTAAAGCGGT
CTGTAGAGGTCCGCCAGGAGTATGCTCTGCAAATCCACTACACGCAAGCTGGTGGTATCACGGGGCACTTCATGCTACTCTGCATGGTTCTCATGTACACCACCGCTCATCACAAGGTCC
GCCAGCAATGTTTCGAAGCGTTCTGGTACACGCATCATCTGGCGTTCTTCTTCTTCATTGCTCTCTGGACCCATGCCGATGGTTGCTTCGTCCGGGATAGCACAAATGCAGCGTACATCG
ATTCGTTTCCCTTCTATAACGCAGAGTTCTGCCTCGGTTATGAGAGTTGGCGTTTCACCATTTGGCCGGGTATCATTTATTTCGGAGAGCGCGTTTGGAGGGAGGTCAGGGCGAGGCGTG
CTACCAGATTGTCTAAGGTCCTCGTTCATCCTAGTG
GTAAGCAATTATTGTTCACTCCTCGGCGTGATGGTGTCTCTTTCTCACATCATATCAGGGGCGATGGAACTCAGAATTGTCAAG
CCGAGCTTCAAGTATGTCGCGGGACAGTGGCTCTTCATTCAAGTCCCAGAGGTCTCCAAGTTTCAATGGCATCCG
GTACGGTCGAAATATGTCCTCGATGTCACGCTGCTAGCTGATTGT
CTGCTTGTCATGATGTTTTCATAGTTCACGATTACTTCGGCCCCCGAGGATCCTTACGTCTCCGTTCATATCAGGCAGGTCGGTGACTTCACGCAGGCACTTGGTGACCGCGTGGGTGCG
GGGCCGTCTGTTGTCGCTGCTATGACGAAGGCTGCCATGATAGGCTCTGAGAAGGATGATTCCGTTTATGGGACGCGTGGCGACTTCGTGGAACTTGATTCAGGTGCTCGTCCTCTGCCA
ACAGTGCGGATCGACGGACCGTACGGCGCCCCGGCCGAAGACGTGTTCAACGTCGAAGTAGCTGTTCTGGTCGGTGCCGGTATTG
GTAAGACTCTACTGTATTGCCATTTCTGTCAGCCA
TGCTAAGATCTCTTCACAGGTGTTACACCGTTTGCGTCTATATTGAAGCATATATGGTACCGTCAGAAGAAGGGCAATCTTCAATCTTTGAAGCGGGTCGAGTTCTTCTGGGTCTGCCGT
GATGCGCCGTCTTTCGGTTGGTTCCAGACCCTCCTGCAAGAGGTCGAGGAGGCCCAAGTTGATC
GTGAGTAACCCATTCGTAGCAAAATAGAGCGCAACTAATGACTCTGTAGCCAACTT
CTTGCGCATCAACATCTATCTCACCCAGAAGATCGGCGAGGATATGCTATGGAACATCGCCCTTAACGACGCTGGCGCTGAGTATGACCCCCTCACTCTGCTTCGCACTCGTACGATGTT
CGGTCGTCCGGACTGGAAGAATATCTATGCCCGCATGAAGCAGGCTATCGAAATGGGTCAGTACCTCCCTGGTACTAAGGAGCAGCTCAAGACGAAAGTTGGC
GTGAGTATACTTTGAAA
TGGTTTCCATAGAGTCGTGAATGCTGAACTCTAAGAAAGACGTACTTCTGCGGACCTGGCGTCATGGCAAAGGCCATCAAAGAGGCCTGCGTGGCTTCGACAACTCCCAACATCAACTTC
ACCTTCGCTAAG
GTTTGCCCTGCTTTGCCACATTCTGTGCGACTACTTACATGTGCGCTATGCAGGAGCACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAAAGCTGGTTCCGTCGCGAGTTCCTCAATCCCCGAAGGCTCATATTCAACGTCTTGTTCTTTGGCCTCCAGGTCTCGTTCTTCTCATATGGATGGTGGGCACAGGCAACCAAT
AAGAAACTAGCTGCTCTCAATGCCCTGCAATGGTCTGTCTGGGTATCTCGTGGTGCTGGTCTCGTGTTGGCCTTCCTCGCCGCCTGTCTCCTTCTTCCTATGCTGCGCAACTGCATCCGA
GTCATCCGTCCCAAAGTCGCCTTCCTCTTCCCAGCTGATGAAAACATTTGGTTCCATCGCCAAGCAGCATACTGTCTCGCTTTCTGGTCCATGGTTCACACCACCGCTCATTATGTGAAC
TTCATCAATGTCGAGCGAACCC
AGGTCCGCCAGGAGTATGCTCTGCAAATCCACTACACGCAAGCTGGTGGTATCACGGGGCACTTCATGCTACTCTGCATGGTTCTCATGTACACCACC
GCTCATCACAAGGTCCGCCAGCAATGTTTCGAAGCGTTCTGGTACACGCATCATCTGGCGTTCTTCTTCTTCATTGCTCTCTGGACCCATGCCGATGGTTGCTTCGTCCGGGATAGCACA
AATGCAGCGTACATCGATTCGTTTCCCTTCTATAACGCAGAGTTCTGCCTCGGTTATGAGAGTTGGCGTTTCACCATTTGGCCGGGTATCATTTATTTCGGAGAGCGCGTTTGGAGGGAG
GTCAGGGCGAGGCGTGCTACCAGATTGTCTAAGGTCCTCGTTCATCCTAGTG
GGGCGATGGAACTCAGAATTGTCAAGCCGAGCTTCAAGTATGTCGCGGGACAGTGGCTCTTCATTCAA
GTCCCAGAGGTCTCCAAGTTTCAATGGCATCCG
TTCACGATTACTTCGGCCCCCGAGGATCCTTACGTCTCCGTTCATATCAGGCAGGTCGGTGACTTCACGCAGGCACTTGGTGACCGC
GTGGGTGCGGGGCCGTCTGTTGTCGCTGCTATGACGAAGGCTGCCATGATAGGCTCTGAGAAGGATGATTCCGTTTATGGGACGCGTGGCGACTTCGTGGAACTTGATTCAGGTGCTCGT
CCTCTGCCAACAGTGCGGATCGACGGACCGTACGGCGCCCCGGCCGAAGACGTGTTCAACGTCGAAGTAGCTGTTCTGGTCGGTGCCGGTATTG
GTGTTACACCGTTTGCGTCTATATTG
AAGCATATATGGTACCGTCAGAAGAAGGGCAATCTTCAATCTTTGAAGCGGGTCGAGTTCTTCTGGGTCTGCCGTGATGCGCCGTCTTTCGGTTGGTTCCAGACCCTCCTGCAAGAGGTC
GAGGAGGCCCAAGTTGATC
CCAACTTCTTGCGCATCAACATCTATCTCACCCAGAAGATCGGCGAGGATATGCTATGGAACATCGCCCTTAACGACGCTGGCGCTGAGTATGACCCCCTC
ACTCTGCTTCGCACTCGTACGATGTTCGGTCGTCCGGACTGGAAGAATATCTATGCCCGCATGAAGCAGGCTATCGAAATGGGTCAGTACCTCCCTGGTACTAAGGAGCAGCTCAAGACG
AAAGTTGGC
ACGTACTTCTGCGGACCTGGCGTCATGGCAAAGGCCATCAAAGAGGCCTGCGTGGCTTCGACAACTCCCAACATCAACTTCACCTTCGCTAAGGAGCACTTCTGA

Retrieve as FASTA