Entry information : PcNOx01
Entry ID 6752
Creation 2009-05-04 (Christophe Dunand)
Last sequence changes 2011-11-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcNOx01
Name PcNOx01
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcNOx01
start..stop
S start..stop
PcarNOx01 1120 0 1..559 1..559
LbiNOx01 975 0 1..559 1..559
PplNOx01-1B 966 0 1..559 1..557
PplNOx01-1A 962 0 1..559 1..557
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 881692..881802 111 N° 2 881853..882123 271 N° 3 882173..882663 491 N° 4 882716..883022 307
N° 5 883079..883243 165 N° 6 883293..883522 230 N° 7 883580..883672 93 N° 8 883720..883731 12
join(881692..881802,881853..882123,882173..882663,882716..883022,883079..883243, 883293..883522,883580..883672,883720..883731)


exon

Literature and cross-references PcNOx01
DNA ref. JGI genome:   scaffold_11 (881692..883731)
mRNA ref. JGI transcript:   134844 [Incorrect splicing]
EST ref. GenBank:   DV758827.1 [5' end]   DV758186.1 [Fragment]
Protein sequence: PcNOx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   559
PWM (Da):   %s   63873.52 Transmb domain:   %s   i16-38o53-75i102-124o139-161i174-196o
PI (pH):   %s   9.33
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGESWFHREFLNPRRLIFNILFYGVQLFLFGYGWYSQETNKKLAALNGLKWSVWTSRGAGLVLAFDGGMILVPMLRNIIRVVRPRLAWLFPADENIWFHRQVAYSMAFWAMVHTTAHYVNFFNVELTQVRPERALDIHYTQAGGITGHFMLLIMVLMYTTAHHKIRNQCFEAFWYTHHLAFFFMIGLYTHATGCFVRDSADPEYIKTFPFYGTEHCLGYESWRFTIWPGIIYFGERVWREIRARRATRLSKVLVHPSGAMELRIVKPSFKYVAGQWLFIQVPDVSGWQWHFTITSAPEDPYVSVHIRQVGDWTRALGERVGAGPSVVAAMTQDAMKGKEKDEALYGTRGNFVELDPARTTRPLPIVRIDGPYGAPAEDVFNVEVAVLVGAGIGVTPFASILKHIWYRQRKGNVGSLRRVEFFWVCRDAPSFGWFQSLLQEVEAAQADPNFLRINIYLTQKIGEDMLWNIAVNDAGAEYDPLTLLRSRTMFGRPDWKSIYGRMRDAIETGQYLPGANSQLKTRVTYFCGPSVLGKAVQEACNTSSTANINFTFAKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns) and 7 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGAGCTGGTTCCACCGCGAATTCCTGAACCCCCGACGACTCATCTTTAACATCCTCTTCTACGGCGTCCAGCTATTTCTCTTTGGGTATGGGTGGTATAGCCAGGTGCGTTCA
ATGCTATTAGTTGCACGGTTAACACTCATTGGGATCCATAGGAAACGAACAAGAAGCTAGCGGCTTTGAACGGTCTCAAATGGTCGGTGTGGACGTCCCGCGGCGCTGGTCTCGTACTTG
CCTTCGATGGCGGCATGATTCTGGTGCCTATGCTACGCAACATCATTCGTGTCGTCCGTCCGAGGCTGGCCTGGCTCTTTCCGGCTGACGAGAATATTTGGTTCCATCGGCAAGTCGCAT
ACTCGATGGCCTTTTGGGCTATGGTTCACACCACTGCGCACTACGTGAACTTTTTCAATGTCGAGCTTACCC
GTACGTCTAAACGTTATATGCTTGCTCTGGTTCTCACCATATGTTGTA
GAGGTCCGTCCCGAGAGGGCTCTCGACATCCACTACACCCAGGCCGGAGGTATCACTGGTCACTTCATGCTGCTCATCATGGTCCTCATGTACACGACTGCGCACCACAAGATTCGCAAC
CAGTGCTTCGAGGCGTTCTGGTACACCCACCATCTCGCCTTCTTCTTCATGATTGGCCTCTACACCCATGCCACTGGATGCTTCGTCCGAGACTCAGCCGACCCAGAGTACATCAAGACC
TTCCCATTCTACGGCACAGAGCACTGCCTCGGATATGAAAGCTGGAGGTTCACTATCTGGCCCGGTATCATCTATTTTGGAGAGCGTGTCTGGCGCGAGATCCGTGCACGACGCGCTACA
CGTCTTTCCAAGGTTCTGGTCCACCCGAGCGGCGCCATGGAATTGCGTATTGTCAAGCCGAGTTTCAAATACGTTGCTGGACAGTGGCTCTTTATCCAGGTGCCCGACGTCTCCGGATGG
CAATGGCATCCC
GTAAGTTGACATAGCTGTACTGGTTGTCATGGGCTTATATTGAGTTCATCAGTTTACCATCACTTCTGCTCCGGAGGACCCCTACGTCTCGGTTCATATTCGCCAGGT
CGGCGATTGGACCCGTGCTCTGGGTGAACGCGTGGGCGCAGGCCCGTCTGTCGTTGCTGCTATGACCCAGGATGCCATGAAGGGCAAAGAGAAAGACGAGGCTTTGTACGGCACTCGTGG
AAACTTCGTTGAGCTCGACCCTGCTCGTACAACTCGTCCCCTTCCAATTGTCCGGATTGATGGTCCTTACGGTGCCCCTGCTGAGGATGTCTTCAATGTCGAGGTTGCTGTCCTGGTCGG
TGCTGGTATCG
GTGAGTGCGCTTTTTACAGCTGCGCTTTGCGTCTATCTCTGACTCGGCATCATCAGGTGTCACCCCATTCGCATCTATCCTGAAGCACATCTGGTACCGCCAGAGAAAG
GGAAATGTAGGCTCTCTGAGGCGTGTTGAGTTCTTCTGGGTCTGCCGCGATGCTCCATCGTTCGGCTGGTTCCAGAGTCTCCTCCAGGAGGTTGAGGCTGCCCAGGCCGATC
GTGAGTCA
ATTCTCTGCTGCACCGATGTAGCAGGCTAATGTAGCGATAGCGAACTTCCTGCGCATCAACATCTATCTCACGCAGAAGATTGGCGAGGACATGCTCTGGAACATTGCCGTCAACGATGC
GGGAGCTGAGTATGACCCGCTTACGTTGCTCCGCTCGCGCACGATGTTTGGCCGACCCGACTGGAAGTCCATTTACGGCCGCATGCGAGATGCTATCGAGACTGGACAATACCTGCCAGG
CGCTAACTCTCAGCTCAAGACGAGGGTTGGG
GTGAGTCTCCACTGCATTGAGCACTGTGAATGTCCCTAATTCCCTGACTTTCTTAAGACCTACTTCTGTGGCCCCAGTGTCCTCGGAAA
GGCCGTCCAGGAAGCGTGCAATACATCCAGCACCGCCAATATCAACTTCACCTTCGCGAAG
GTATGTTTGCTCCCTTAGAAACATTTTAGCTACTGACAGGCGCCTAGGAACACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGAGCTGGTTCCACCGCGAATTCCTGAACCCCCGACGACTCATCTTTAACATCCTCTTCTACGGCGTCCAGCTATTTCTCTTTGGGTATGGGTGGTATAGCCAGGAAACGAAC
AAGAAGCTAGCGGCTTTGAACGGTCTCAAATGGTCGGTGTGGACGTCCCGCGGCGCTGGTCTCGTACTTGCCTTCGATGGCGGCATGATTCTGGTGCCTATGCTACGCAACATCATTCGT
GTCGTCCGTCCGAGGCTGGCCTGGCTCTTTCCGGCTGACGAGAATATTTGGTTCCATCGGCAAGTCGCATACTCGATGGCCTTTTGGGCTATGGTTCACACCACTGCGCACTACGTGAAC
TTTTTCAATGTCGAGCTTACCC
AGGTCCGTCCCGAGAGGGCTCTCGACATCCACTACACCCAGGCCGGAGGTATCACTGGTCACTTCATGCTGCTCATCATGGTCCTCATGTACACGACT
GCGCACCACAAGATTCGCAACCAGTGCTTCGAGGCGTTCTGGTACACCCACCATCTCGCCTTCTTCTTCATGATTGGCCTCTACACCCATGCCACTGGATGCTTCGTCCGAGACTCAGCC
GACCCAGAGTACATCAAGACCTTCCCATTCTACGGCACAGAGCACTGCCTCGGATATGAAAGCTGGAGGTTCACTATCTGGCCCGGTATCATCTATTTTGGAGAGCGTGTCTGGCGCGAG
ATCCGTGCACGACGCGCTACACGTCTTTCCAAGGTTCTGGTCCACCCGAGCGGCGCCATGGAATTGCGTATTGTCAAGCCGAGTTTCAAATACGTTGCTGGACAGTGGCTCTTTATCCAG
GTGCCCGACGTCTCCGGATGGCAATGGCATCCC
TTTACCATCACTTCTGCTCCGGAGGACCCCTACGTCTCGGTTCATATTCGCCAGGTCGGCGATTGGACCCGTGCTCTGGGTGAACGC
GTGGGCGCAGGCCCGTCTGTCGTTGCTGCTATGACCCAGGATGCCATGAAGGGCAAAGAGAAAGACGAGGCTTTGTACGGCACTCGTGGAAACTTCGTTGAGCTCGACCCTGCTCGTACA
ACTCGTCCCCTTCCAATTGTCCGGATTGATGGTCCTTACGGTGCCCCTGCTGAGGATGTCTTCAATGTCGAGGTTGCTGTCCTGGTCGGTGCTGGTATCG
GTGTCACCCCATTCGCATCT
ATCCTGAAGCACATCTGGTACCGCCAGAGAAAGGGAAATGTAGGCTCTCTGAGGCGTGTTGAGTTCTTCTGGGTCTGCCGCGATGCTCCATCGTTCGGCTGGTTCCAGAGTCTCCTCCAG
GAGGTTGAGGCTGCCCAGGCCGATC
CGAACTTCCTGCGCATCAACATCTATCTCACGCAGAAGATTGGCGAGGACATGCTCTGGAACATTGCCGTCAACGATGCGGGAGCTGAGTATGAC
CCGCTTACGTTGCTCCGCTCGCGCACGATGTTTGGCCGACCCGACTGGAAGTCCATTTACGGCCGCATGCGAGATGCTATCGAGACTGGACAATACCTGCCAGGCGCTAACTCTCAGCTC
AAGACGAGGGTTGGG
ACCTACTTCTGTGGCCCCAGTGTCCTCGGAAAGGCCGTCCAGGAAGCGTGCAATACATCCAGCACCGCCAATATCAACTTCACCTTCGCGAAGGAACACTTCTGA

Retrieve as FASTA