Entry information : PcNOx02
Entry ID 6753
Creation 2009-05-04 (Christophe Dunand)
Last sequence changes 2009-05-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcNOx02
Name PcNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcNOx02
start..stop
S start..stop
PcarNOx02 1165 0 1..609 1..611
LbiNOx02 1052 0 1..609 1..604
PplNOx02-1B 1013 0 8..609 7..609
PplNOx02-1A 1011 0 8..609 7..609
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1153410..1153785 376 N° 2 1152851..1153353 503 N° 3 1152568..1152788 221 N° 4 1152241..1152516 276
N° 5 1151841..1152189 349 N° 6 1151691..1151784 94 N° 7 1151620..1151630 11  
complement(join(1151620..1151630,1151691..1151784,1151841..1152189,1152241..1152 516,1152568..1152788,1152851..1153353,1153410..1153785))


exon

Literature and cross-references PcNOx02
DNA ref. JGI genome:   scaffold_5 (1153785..1151620)
mRNA ref. JGI transcript:   3794
Protein sequence: PcNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   609
PWM (Da):   %s   70034.18 Transmb domain:   %s   i88-110o125-147i177-199o219-241i254-276o291-309i439-461o
PI (pH):   %s   10.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYYTTQKRSSGLDFSDGKMPALEQHPDIALPGSQPSHLQRNKTERRRLQGLQRSNTTSAYAQVQPYQPRTLREKWDLWMINEGGRRMFFFVWIFLHLLVFVFGTLHYQLKDNLNGARNTFGVTFTIARTAALVLHVDVIFILLPVCRNFISLVRRTPLNHYIPFDKNITFHKATAWSIVFWTIVHIVAHMVNFTKLALSDKDAKNAGQVIVAFLAANFATGPGLTGWIMTAALGIMVWFAIEKRRRAHFEWFWYTHHLFIVFFINWQLHGMFCMIKPDRPPYCSYNTIGVFRYWLVGGVIWIFERILREVRSRHRTYIHKVIQHPSNVLELQIKKEKTTTRAGQYIFLSCPEISYFQWHPFTLTSAPEEDYISVHIRVVGDFTRALAKAVGCDFDKKDKGEKGGDSKVVGTAANPPLNRVLPRVMVDGPFGSASEDFLNYETVLLVGAGIGVTPFASILKSIWYRMNNFNNSKPTRLSKVYFTWVIRDFGSAEWFHSLLHAIEEQDTQNRIEINIYLTAKIKEDDMTNIIVQDVGAEKDAITSLRAPTHFGRPNWDRVFSSIAEKHPETDVGFFCGPAVLSRQLHTMSNKYSNPKGTRFFFGKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns) and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATACTACACCACCCAGAAGCGTTCGTCCGGCCTCGATTTCTCCGACGGCAAGATGCCTGCGCTGGAGCAGCATCCGGACATCGCTCTGCCAGGTAGCCAGCCGAGCCACTTGCAG
CGCAACAAGACGGAGCGCAGGCGACTCCAGGGGCTGCAGCGGTCGAACACGACCAGCGCGTACGCGCAGGTCCAGCCGTACCAGCCCCGCACGCTGCGCGAGAAGTGGGACCTCTGGATG
ATCAACGAGGGAGGCCGCCGCATGTTCTTCTTCGTCTGGATATTCCTCCACCTCCTCGTCTTTGTCTTCGGCACTCTTCATTACCAGCTCAAGGATAACCTGAATGGCGCGCGGAATACG
TTCGGCGTCACCTTCA
GTACGTGTCTCATTAAGCTCCTCGACGCGTCGTGCTCAACTCCTCCCCCTGCGTAGCAATCGCTCGTACGGCCGCCCTGGTGCTGCACGTCGATGTGATCTTTA
TTCTGCTGCCCGTCTGCCGCAACTTTATCTCCCTCGTCCGGCGCACGCCTCTCAACCACTACATCCCCTTCGACAAGAACATCACGTTCCACAAGGCGACGGCCTGGTCCATCGTCTTCT
GGACGATTGTCCACATTGTCGCCCACATGGTCAACTTTACGAAACTCGCACTTTCAGACAAGGACGCGAAGAACGCAGGCCAGGTTATCGTCGCCTTCTTGGCAGCGAACTTCGCAACCG
GCCCTGGCCTCACCGGCTGGATCATGACGGCCGCACTGGGCATCATGGTCTGGTTCGCAATAGAGAAACGCCGCCGTGCGCACTTTGAGTGGTTCTGGTACACGCACCACCTCTTCATCG
TCTTCTTTATCAACTGGCAGCTCCACGGCATGTTCTGCATGATCAAGCCCGACCGGCCGCCATACTGCTCGTACAACACTATTGGTGTCTTCTGG
GTGCGTATCGCACGGCTCTCCGGTA
CATGAACGTGCGAACTGAGGATCGTTTTTGATTGCAGCGCTACTGGCTTGTTGGAGGTGTCATCTGGATCTTCGAGCGTATCCTTCGCGAAGTCCGCTCGCGTCACAGGACCTACATTCA
CAAGGTCATCCAGCACCCATCCAACGTCCTGGAGCTGCAGATCAAGAAGGAGAAGACCACGACGCGTGCCGGCCAGTACATCTTCCTCTCGTGCCCTGAAATCTCCTACTTCCAGTGGCA
CCCCTTCACACTTACCAG
GTACGCGGCTCTGGGGCCTCCGCCATTTGCATATATTGACGTAGTTCTCAGCGCTCCGGAGGAAGATTACATCTCCGTCCACATTCGCGTGGTCGGTGACTT
CACGAGGGCCCTTGCAAAGGCCGTCGGTTGCGATTTCGACAAGAAAGACAAGGGCGAGAAGGGTGGCGATAGCAAAGTCGTTGGCACCGCGGCCAACCCTCCGTTGAACCGCGTTCTTCC
TCGGGTCATGGTCGACGGCCCCTTTGGTAGTGCAAGTGAAGACTTCCTGAACTACGAGACTGTCTTGCTCGTTGGGGCAGGTATTGGCGTGACCCCATTCGCTTC
GTACGTACCGTCTTA
AGTCTGGATGATCCACCTCTTACGCATCCTAAACAGGATTCTGAAGTCTATCTGGTACCGTATGAACAACTTCAACAACTCGAAGCCGACTCGTCTGTCAAAGGTGTACTTCACCTGGGT
CATCCGTGACTTTGGTAGCGCCGAGTGGTTCCACTCTCTCCTGCACGCCATTGAGGAGCAGGACACTCAGAACCGCATCGAGATCAACATCTACCTGACTGCTAAGATCAAGGAAGACGA
CATGACCAACATTATCGTTCAGGACGTCGGTGCTGAGAAGGATGCGATTACGTCTCTCCGAGCCCCTACACACTTTGGCCGCCCCAACTGGGACCGCGTCTTCAGCTCCATTGCCGAGAA
GCACCCTGAAACCGACGTCGGCGTG
GTATGTGACTTGTGGTTTGAAGCATTTGGGCTGCACTCACTCTCGGCGTCCATCAGTTCTTCTGCGGTCCAGCTGTGCTATCGCGTCAGTTGCAC
ACAATGAGCAACAAGTATTCGAACCCCAAGGGCACGAGATTCTTCTTCGGGAAGG
GTACGCCTACCTCGTGTTTTCCATTGCATTCGGGTTGCTGACAGATGTCTCCTCTCACAGAGAAC
TTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATACTACACCACCCAGAAGCGTTCGTCCGGCCTCGATTTCTCCGACGGCAAGATGCCTGCGCTGGAGCAGCATCCGGACATCGCTCTGCCAGGTAGCCAGCCGAGCCACTTGCAG
CGCAACAAGACGGAGCGCAGGCGACTCCAGGGGCTGCAGCGGTCGAACACGACCAGCGCGTACGCGCAGGTCCAGCCGTACCAGCCCCGCACGCTGCGCGAGAAGTGGGACCTCTGGATG
ATCAACGAGGGAGGCCGCCGCATGTTCTTCTTCGTCTGGATATTCCTCCACCTCCTCGTCTTTGTCTTCGGCACTCTTCATTACCAGCTCAAGGATAACCTGAATGGCGCGCGGAATACG
TTCGGCGTCACCTTCA
CAATCGCTCGTACGGCCGCCCTGGTGCTGCACGTCGATGTGATCTTTATTCTGCTGCCCGTCTGCCGCAACTTTATCTCCCTCGTCCGGCGCACGCCTCTCAAC
CACTACATCCCCTTCGACAAGAACATCACGTTCCACAAGGCGACGGCCTGGTCCATCGTCTTCTGGACGATTGTCCACATTGTCGCCCACATGGTCAACTTTACGAAACTCGCACTTTCA
GACAAGGACGCGAAGAACGCAGGCCAGGTTATCGTCGCCTTCTTGGCAGCGAACTTCGCAACCGGCCCTGGCCTCACCGGCTGGATCATGACGGCCGCACTGGGCATCATGGTCTGGTTC
GCAATAGAGAAACGCCGCCGTGCGCACTTTGAGTGGTTCTGGTACACGCACCACCTCTTCATCGTCTTCTTTATCAACTGGCAGCTCCACGGCATGTTCTGCATGATCAAGCCCGACCGG
CCGCCATACTGCTCGTACAACACTATTGGTGTCTTCTGG
CGCTACTGGCTTGTTGGAGGTGTCATCTGGATCTTCGAGCGTATCCTTCGCGAAGTCCGCTCGCGTCACAGGACCTACATT
CACAAGGTCATCCAGCACCCATCCAACGTCCTGGAGCTGCAGATCAAGAAGGAGAAGACCACGACGCGTGCCGGCCAGTACATCTTCCTCTCGTGCCCTGAAATCTCCTACTTCCAGTGG
CACCCCTTCACACTTACCAG
CGCTCCGGAGGAAGATTACATCTCCGTCCACATTCGCGTGGTCGGTGACTTCACGAGGGCCCTTGCAAAGGCCGTCGGTTGCGATTTCGACAAGAAAGAC
AAGGGCGAGAAGGGTGGCGATAGCAAAGTCGTTGGCACCGCGGCCAACCCTCCGTTGAACCGCGTTCTTCCTCGGGTCATGGTCGACGGCCCCTTTGGTAGTGCAAGTGAAGACTTCCTG
AACTACGAGACTGTCTTGCTCGTTGGGGCAGGTATTGGCGTGACCCCATTCGCTTC
GATTCTGAAGTCTATCTGGTACCGTATGAACAACTTCAACAACTCGAAGCCGACTCGTCTGTCA
AAGGTGTACTTCACCTGGGTCATCCGTGACTTTGGTAGCGCCGAGTGGTTCCACTCTCTCCTGCACGCCATTGAGGAGCAGGACACTCAGAACCGCATCGAGATCAACATCTACCTGACT
GCTAAGATCAAGGAAGACGACATGACCAACATTATCGTTCAGGACGTCGGTGCTGAGAAGGATGCGATTACGTCTCTCCGAGCCCCTACACACTTTGGCCGCCCCAACTGGGACCGCGTC
TTCAGCTCCATTGCCGAGAAGCACCCTGAAACCGACGTCGGCGTG
TTCTTCTGCGGTCCAGCTGTGCTATCGCGTCAGTTGCACACAATGAGCAACAAGTATTCGAACCCCAAGGGCACG
AGATTCTTCTTCGGGAAGG
AGAACTTCTGA

Retrieve as FASTA