Entry information : PcFRe01
Entry ID 6756
Creation 2009-05-04 (Christophe Dunand)
Last sequence changes 2009-05-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PcFRe01
Name PcFRe01
Class Ferric Reductase    [Orthogroup: FRe002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete chrysosporium    [TaxId: 5306 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcFRe01
start..stop
S start..stop
CcinFRe02 157 2e-41 243..753 59..537
CcinFRe03 158 7e-41 243..753 176..674
CcinFRe01 154 3e-40 242..731 24..502
ArubFRe01 154 2e-39 230..753 194..743
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 236333..236800 468 N° 2 236246..236286 41 N° 3 235840..236190 351 N° 4 235556..235785 230
N° 5 235433..235488 56 N° 6 235262..235383 122 N° 7 234893..235211 319 N° 8 234095..234769 675
complement(join(234095..234769,234893..235211,235262..235383,235433..235488,2355 56..235785,235840..236190,236246..236286,236333..236800))


exon

Literature and cross-references PcFRe01
DNA ref. JGI genome:   scaffold_3 (236800..234095)
mRNA ref. JGI transcript:   137860
Protein sequence: PcFRe01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   753 (730)
PWM (Da):   %s   85062.61 (82636.2) Transmb domain:   %s   o169-191i261-283o298-320i341-361o376-398i405-427o (o146-168i238-260o275-297i318-338o353-375i382-404o)
PI (pH):   %s   7.42 (7.16) Peptide Signal:   %s   cut: 24 range:24-753
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTLRQKILLCFASLLVLVGGAQADRTYNKPELCAYACYDTIASFTFGDYDVNDSYVGQRCDSRLAVSSVYACWDLRCSGQYTPEQSFDYLEWYCAEYGFTTMNGTYSDVIQDLIAEYGSVDKVPTIDPTDPASLVEIINTTVVVPTENYVLSYKTLEVWQHEMHMHHTYGWSMYVMAGGVVFIGVVNRLMAFLVHRLLARNPLPADAERSAAIFGKGAAPNTGILTKVHNLLAKHVMLPATFGYRHIQPLGWCTIPTRLQSILVFLFFALNFIFCAVDWHLFPGNTYWSDPASQFWRYFADRTGIISFANLPLVWLFAGRNDVLLWLTGWSFSTFNIFHRYAARIATVQGILHSIAYTIGYYRWSEYKLEVPEVWFYSGIATVFMSFIVGLSILPIRAKAYELFLVIHITFSVALLVFLFYHVDIFDGEYNPYLWACVAIWGFDRFLRLVRLVVLNYRAFVPGKNDPLKRSKATAVYDPEGDIIRLTVRPSTNILVGAGIHYYIYTPTASSLRLWENHPFTLGSWSDVQLHHSQQELMFLVRPYKGMTNTLKKQLLKAPGHRMDIRVLIEGPYGVAADLQQYERTLMIAGGSGVTGILAYLYEFGRKAERGAMAGRHLRFVWAAREPRFVADVLEKDLAPFADRDDVHLDLCMTRGLESDKAGIVEKAVARTSKGSLKKGPTTAVVYARPNIAELLEQEIEQLVSETSRLAVVVCGPGRLADDVRREVVRSIGTKIDASRIELYEESFGW*

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGCTACGCCAAAAAATCCTCCTTTGCTTCGCATCGCTGCTCGTCCTTGTCGGTGGCGCTCAGGCCGACCGCACGTACAACAAGCCCGAGTTGTGCGCGTACGCCTGCTACGACACC
ATCGCCAGCTTCACTTTCGGCGACTACGACGTCAACGACAGCTATGTCGGTCAGCGCTGCGACTCGCGGCTCGCCGTAAGCTCTGTATACGCCTGCTGGGACCTCAGGTGCAGCGGCCAG
TACACGCCGGAGCAGAGCTTCGATTATCTGGAGTGGTATTGTGCGGAGTACGGCTTCACCACCATGAATGGCACCTACTCGGACGTGATTCAAGATCTCATCGCCGAGTACGGAAGCGTC
GACAAGGTCCCGACGATCGACCCTACCGACCCGGCCTCCTTGGTTGAAATCATCAACACCACGGTCGTAGTCCCCACGGAGAATTATGTGCTGTCCTATAAGACCTTG
GTATGTCAGGCC
AGATTCTGTGTAGTCTTTATTGACGCCATTGCAGGAAGTATGGCAGCACGAGATGCACATGCACCACACCTACGGGTATGTCACCTTTTTCGTGTTATCTAACATGGTAGCTTACGCGTG
GAATCGTCAGCTGGAGCATGTATGTCATGGCGGGAGGCGTCGTATTCATCGGTGTTGTGAACCGGCTCATGGCGTTTTTGGTCCACCGTCTTCTCGCGCGGAATCCCCTGCCCGCTGACG
CGGAACGTTCGGCCGCTATCTTCGGCAAGGGTGCTGCACCGAACACGGGCATTCTCACCAAGGTCCACAACCTTCTGGCGAAGCATGTTATGCTTCCCGCCACCTTCGGTTACCGCCACA
TTCAGCCCTTGGGATGGTGCACAATCCCGACACGGCTGCAGTCGATTCTGGTCTTCCTCTTCTTCGCCCTGAACTTTATCTTCTGCGCCGTCGACTGGCATTTGTTTCCCGGCAACACCT
A
GTGAGTACGACCGCTACGTTACGCACATCACCGTATCGCTGACTGACTGCCTAGCTGGTCTGATCCTGCAAGCCAGTTCTGGCGGTATTTCGCGGACAGGACGGGGATCATTTCTTTCG
CCAACCTGCCGCTTGTGTGGCTGTTCGCGGGTCGAAATGATGTCCTCCTCTGGCTGACGGGCTGGTCGTTCTCTACCTTCAACATTTTCCACCGCTACGCTGCCCGGATCGCGACGGTCC
AAGGTATCTTGCACTCCATCGCGTACACGATCGGATACTACCGGA
GTAAGCACCGTCCTCGCCTCCGTTTTAGCCCTAAGCACCCGCTGATCATCTGCTGCAGCCTATGGAGGATGGAGC
GAATACAAGTTGGAGGTGCCAGAGGTGTGGTTCTATAGCGGTATCTGT
GTAAGCTCCAGCTATCCGAGGCTATGGTGCACAATTGACATGACTCCAGGCTACCGTCTTCATGTCGTTTAT
CGTCGGCCTATCGATACTACCTATACGCGCAAAAGCCTACGAGCTCTTCCTGGTCATCCATATCACCTTCTCCGTCGCCCTACTCGTCTTCCTGTTCTA
GTAAGCATTGCTATCTTTGTC
CAGTGGGCACTACTCACATCCAAGTACAGCCATGTCGACATCTTCGACGGCGAGTATAACCCGTACTTGTGGGCCTGCGTCGCCATCTGGGGTTTCGATCGCTTCCTGCGTCTCGTACGC
CTCGTCGTCCTCAACTACCGCGCCTTCGTCCCTGGAAAGAACGATCCCCTTAAGCGCAGCAAGGCAACCGCTGTCTACGATCCCGAAGGCGACATCATCCGCCTCACCGTCCGTCCCTCC
ACCAACATCCTCGTTGGCGCGGGCATCCACTACTACATCTACACGCCAACGGCATCCTCCCTCAGGCTCTGGGAGAACCACCCTTTCACCCTCGGTTCCTGGTCAAGC
GTCGCAGCGCCC
ACTGATGCCCCCGCTCACGAGTCCGCCATCCAAGCCTCAGGCGTCGTTGACCCGATCTCCCCCATTTCCACCCACTCCTGCGACTCCAAGTCCTTCTCGAGCACGGGAAAGGACGTCCAA
CTCCATCATTCGCAGCAGGAACTGATGTTCCTCGTCCGCCCCTACAAGGGCATGACAAACACGCTCAAGAAGCAGCTGCTCAAAGCGCCGGGACACCGGATGGACATTCGCGTGCTCATC
GAAGGCCCGTACGGCGTCGCGGCGGACCTGCAGCAGTACGAGCGCACGCTCATGATTGCAGGGGGCTCCGGCGTCACCGGCATCCTCGCGTATCTCTACGAGTTCGGGCGCAAGGCCGAG
CGTGGCGCCATGGCTGGCCGCCACCTGCGCTTTGTGTGGGCAGCTCGCGAGCCGCGGTTCGTCGCGGACGTGCTCGAGAAGGACCTCGCACCGTTTGCGGACCGCGACGACGTCCATCTC
GACCTCTGCATGACGCGCGGTCTCGAGAGCGATAAGGCCGGCATCGTCGAGAAGGCTGTTGCTCGTACGTCCAAGGGTTCGCTGAAGAAAGGTCCGACGACGGCGGTGGTGTACGCCCGG
CCAAATATTGCGGAGCTTCTGGAGCAGGAAATTGAGCAGCTCGTGTCCGAGACCAGTCGTTTGGCCGTCGTCGTCTGCGGGCCTGGCAGGCTTGCTGATGACGTTCGGCGCGAGGTCGTA
CGCAGCATCGGCACGAAGATTGACGCGTCCCGGATCGAGCTGTACGAGGAGAGTTTCGGTTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGCTACGCCAAAAAATCCTCCTTTGCTTCGCATCGCTGCTCGTCCTTGTCGGTGGCGCTCAGGCCGACCGCACGTACAACAAGCCCGAGTTGTGCGCGTACGCCTGCTACGACACC
ATCGCCAGCTTCACTTTCGGCGACTACGACGTCAACGACAGCTATGTCGGTCAGCGCTGCGACTCGCGGCTCGCCGTAAGCTCTGTATACGCCTGCTGGGACCTCAGGTGCAGCGGCCAG
TACACGCCGGAGCAGAGCTTCGATTATCTGGAGTGGTATTGTGCGGAGTACGGCTTCACCACCATGAATGGCACCTACTCGGACGTGATTCAAGATCTCATCGCCGAGTACGGAAGCGTC
GACAAGGTCCCGACGATCGACCCTACCGACCCGGCCTCCTTGGTTGAAATCATCAACACCACGGTCGTAGTCCCCACGGAGAATTATGTGCTGTCCTATAAGACCTTG
GAAGTATGGCAG
CACGAGATGCACATGCACCACACCTACGG
CTGGAGCATGTATGTCATGGCGGGAGGCGTCGTATTCATCGGTGTTGTGAACCGGCTCATGGCGTTTTTGGTCCACCGTCTTCTCGCGCGG
AATCCCCTGCCCGCTGACGCGGAACGTTCGGCCGCTATCTTCGGCAAGGGTGCTGCACCGAACACGGGCATTCTCACCAAGGTCCACAACCTTCTGGCGAAGCATGTTATGCTTCCCGCC
ACCTTCGGTTACCGCCACATTCAGCCCTTGGGATGGTGCACAATCCCGACACGGCTGCAGTCGATTCTGGTCTTCCTCTTCTTCGCCCTGAACTTTATCTTCTGCGCCGTCGACTGGCAT
TTGTTTCCCGGCAACACCTA
CTGGTCTGATCCTGCAAGCCAGTTCTGGCGGTATTTCGCGGACAGGACGGGGATCATTTCTTTCGCCAACCTGCCGCTTGTGTGGCTGTTCGCGGGTCGA
AATGATGTCCTCCTCTGGCTGACGGGCTGGTCGTTCTCTACCTTCAACATTTTCCACCGCTACGCTGCCCGGATCGCGACGGTCCAAGGTATCTTGCACTCCATCGCGTACACGATCGGA
TACTACCGGA
GATGGAGCGAATACAAGTTGGAGGTGCCAGAGGTGTGGTTCTATAGCGGTATCTGTGCTACCGTCTTCATGTCGTTTATCGTCGGCCTATCGATACTACCTATACGCGCA
AAAGCCTACGAGCTCTTCCTGGTCATCCATATCACCTTCTCCGTCGCCCTACTCGTCTTCCTGTTCTA
CCATGTCGACATCTTCGACGGCGAGTATAACCCGTACTTGTGGGCCTGCGTC
GCCATCTGGGGTTTCGATCGCTTCCTGCGTCTCGTACGCCTCGTCGTCCTCAACTACCGCGCCTTCGTCCCTGGAAAGAACGATCCCCTTAAGCGCAGCAAGGCAACCGCTGTCTACGAT
CCCGAAGGCGACATCATCCGCCTCACCGTCCGTCCCTCCACCAACATCCTCGTTGGCGCGGGCATCCACTACTACATCTACACGCCAACGGCATCCTCCCTCAGGCTCTGGGAGAACCAC
CCTTTCACCCTCGGTTCCTGGTCAAGC
GACGTCCAACTCCATCATTCGCAGCAGGAACTGATGTTCCTCGTCCGCCCCTACAAGGGCATGACAAACACGCTCAAGAAGCAGCTGCTCAAA
GCGCCGGGACACCGGATGGACATTCGCGTGCTCATCGAAGGCCCGTACGGCGTCGCGGCGGACCTGCAGCAGTACGAGCGCACGCTCATGATTGCAGGGGGCTCCGGCGTCACCGGCATC
CTCGCGTATCTCTACGAGTTCGGGCGCAAGGCCGAGCGTGGCGCCATGGCTGGCCGCCACCTGCGCTTTGTGTGGGCAGCTCGCGAGCCGCGGTTCGTCGCGGACGTGCTCGAGAAGGAC
CTCGCACCGTTTGCGGACCGCGACGACGTCCATCTCGACCTCTGCATGACGCGCGGTCTCGAGAGCGATAAGGCCGGCATCGTCGAGAAGGCTGTTGCTCGTACGTCCAAGGGTTCGCTG
AAGAAAGGTCCGACGACGGCGGTGGTGTACGCCCGGCCAAATATTGCGGAGCTTCTGGAGCAGGAAATTGAGCAGCTCGTGTCCGAGACCAGTCGTTTGGCCGTCGTCGTCTGCGGGCCT
GGCAGGCTTGCTGATGACGTTCGGCGCGAGGTCGTACGCAGCATCGGCACGAAGATTGACGCGTCCCGGATCGAGCTGTACGAGGAGAGTTTCGGTTGGTGA

Retrieve as FASTA