Entry information : BdeNOx02
Entry ID 6770
Creation 2009-05-10 (Christophe Dunand)
Last sequence changes 2009-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: BdeNOx02
Name BdeNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium
Organism Batrachochytrium dendrobatidis    [TaxId: 109871 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeNOx02
start..stop
S start..stop
CgNOx02 505 4e-175 15..541 37..583
GzNOx02 504 1e-174 2..541 8..570
GmoNOx02 498 2e-172 2..541 8..572
NcNOx02 496 2e-171 2..541 20..581
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 898469..898589 121 N° 2 898644..898885 242 N° 3 898956..900218 1263  
join(898469..898589,898644..898885,898956..900218)


exon

Literature and cross-references BdeNOx02
DNA ref. JGI genome:   scaffold_10 (898469..900218)
mRNA ref. JGI transcript:   20394
Protein sequence: BdeNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   541
PWM (Da):   %s   62255.67 Transmb domain:   %s   i45-67o87-109i130-149o164-186i198-220o
PI (pH):   %s   8.99
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNSRPQQTSFQNELSLGAVRPRQRKSGWMVTFNNWMVNEGRSRLFFALFIASQLGYFAWSYYQLWTSPTLVTFRTVLQHGLPMARAAANVINLDCGIILFTVCRNVISLMRTTFLNRIIFDKNITFHIWIAYSIAFWTFVHVIAHYFNYNNVRIALGVSAEYLSLVSGPGLTGQVISVSFFLIFTSAMEAVRRKYFEIFWFTHHLFLVFFGALLMHGSFCFIKGDSGDPCRGGPMFWKFWVGSAAFYLIERLWREISGRRKTYIFKVVQHPSKVVEVQIKKNGWKMQAGQYIFICCPEIGLFEWHPFTLTSSPHEEFLSIHIRVVGDWTEKFAERVGCRFGGSSDNMPAPDTLPYVMVDGPYGSASEDVFDYEAAVLVGAGIGVTPFASILKTIWFRINNPTRAVPLKKVYFFWICRDKDAFEWFQDLLSTIEDENISNFLEIHTYLTQKLKIFEVKNIVINDGEDGRDAITGLKSRTQYGRPNWDQIFEALRVKHRATDIGVFFCGPKVLSRTLHHTCNKWTEATEDGTRFYYGKENF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGAATTCTCGACCTCAACAAACTTCCTTTCAGAATGAATTGAGTCTTGGTGCTGTTCGTCCAAGACAACGAAAGTCGGGCTGGATGGTGACTTTCAATAACTGGATGGTCAATGAA
G
GTACTTTTTGGGTTTGTTTGTGTTGATTATCAACTGCGCTAACATTCGATTCAGGGCGTAGTAGACTATTCTTTGCTTTGTTCATTGCATCCCAATTGGGTTACTTTGCTTGGTCTTAT
TATCAACTATGGACTTCTCCTACTCTTGTTACGTTTCGCACTGTGTTACAACATGGTTTACCCATGGCAAGAGCCGCTGCCAACGTCATCAATTTGGACTGTGGCATCATTCTTTTTACT
GTTTGTCGAAACGTCATTTCTTTAATGCGCACTACTTTTTTAAATCGTATTATACCA
GTTGAGTACAGTCTACTTGAATTGATTATACTCTTTTATTTTCTATTACTTATTCTGTCTTGA
ATTATAGTTTGATAAAAATATCACATTCCATATTTGGATTGCCTATTCCATTGCGTTTTGGACTTTTGTTCATGTCATTGCTCACTACTTCAACTACAATAATGTTCGTATTGCCTTGGG
CGTGTCTGCCGAATACCTCTCTCTTGTATCTGGTCCTGGCCTTACGGGTCAAGTCATCTCCGTGTCATTCTTTCTTATATTCACATCCGCTATGGAAGCTGTGCGTCGCAAGTACTTTGA
AATATTCTGGTTCACCCATCATCTATTCCTTGTCTTCTTTGGTGCTTTGTTAATGCATGGCTCCTTTTGCTTCATCAAAGGCGACTCGGGTGACCCTTGTCGTGGTGGCCCAATGTTTTG
GAAGTTTTGGGTTGGCTCTGCTGCCTTTTATCTAATTGAACGCTTGTGGCGTGAAATCTCGGGCCGTCGCAAAACCTATATTTTTAAAGTGGTCCAGCATCCTTCCAAGGTTGTTGAAGT
TCAGATCAAAAAAAATGGTTGGAAAATGCAGGCTGGCCAGTACATATTTATTTGCTGTCCTGAAATCGGTCTATTCGAATGGCATCCTTTTACCCTAACCTCTTCTCCCCACGAAGAGTT
TCTTTCTATCCATATCCGCGTTGTCGGTGACTGGACTGAAAAGTTTGCTGAACGTGTTGGCTGTCGCTTTGGTGGCTCTTCTGATAATATGCCTGCTCCAGATACTCTTCCCTATGTCAT
GGTCGATGGTCCTTATGGATCTGCATCTGAAGATGTGTTTGATTACGAAGCTGCTGTTCTCGTTGGTGCTGGCATTGGTGTCACTCCCTTTGCCTCAATTCTCAAGACAATCTGGTTTCG
CATCAACAACCCTACTCGTGCCGTACCACTTAAAAAGGTTTATTTCTTTTGGATCTGCAGAGACAAGGATGCTTTCGAGTGGTTCCAAGATTTACTTTCCACAATTGAAGATGAAAACAT
TTCAAATTTCCTGGAAATCCACACTTATTTGACACAGAAACTCAAAATATTTGAAGTCAAAAACATTGTCATCAATGACGGTGAGGATGGCAGAGATGCGATTACCGGACTAAAGTCTCG
TACACAATATGGTCGTCCCAACTGGGACCAAATCTTTGAAGCTCTGCGAGTAAAGCATCGAGCCACAGACATTGGTGTCTTTTTCTGTGGTCCCAAAGTATTATCTCGGACTCTCCATCA
CACATGCAACAAATGGACCGAAGCTACTGAAGATGGAACTCGGTTCTACTATGGCAAAGAGAATTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGAATTCTCGACCTCAACAAACTTCCTTTCAGAATGAATTGAGTCTTGGTGCTGTTCGTCCAAGACAACGAAAGTCGGGCTGGATGGTGACTTTCAATAACTGGATGGTCAATGAA
G
GGCGTAGTAGACTATTCTTTGCTTTGTTCATTGCATCCCAATTGGGTTACTTTGCTTGGTCTTATTATCAACTATGGACTTCTCCTACTCTTGTTACGTTTCGCACTGTGTTACAACAT
GGTTTACCCATGGCAAGAGCCGCTGCCAACGTCATCAATTTGGACTGTGGCATCATTCTTTTTACTGTTTGTCGAAACGTCATTTCTTTAATGCGCACTACTTTTTTAAATCGTATTATA
CCA
TTTGATAAAAATATCACATTCCATATTTGGATTGCCTATTCCATTGCGTTTTGGACTTTTGTTCATGTCATTGCTCACTACTTCAACTACAATAATGTTCGTATTGCCTTGGGCGTG
TCTGCCGAATACCTCTCTCTTGTATCTGGTCCTGGCCTTACGGGTCAAGTCATCTCCGTGTCATTCTTTCTTATATTCACATCCGCTATGGAAGCTGTGCGTCGCAAGTACTTTGAAATA
TTCTGGTTCACCCATCATCTATTCCTTGTCTTCTTTGGTGCTTTGTTAATGCATGGCTCCTTTTGCTTCATCAAAGGCGACTCGGGTGACCCTTGTCGTGGTGGCCCAATGTTTTGGAAG
TTTTGGGTTGGCTCTGCTGCCTTTTATCTAATTGAACGCTTGTGGCGTGAAATCTCGGGCCGTCGCAAAACCTATATTTTTAAAGTGGTCCAGCATCCTTCCAAGGTTGTTGAAGTTCAG
ATCAAAAAAAATGGTTGGAAAATGCAGGCTGGCCAGTACATATTTATTTGCTGTCCTGAAATCGGTCTATTCGAATGGCATCCTTTTACCCTAACCTCTTCTCCCCACGAAGAGTTTCTT
TCTATCCATATCCGCGTTGTCGGTGACTGGACTGAAAAGTTTGCTGAACGTGTTGGCTGTCGCTTTGGTGGCTCTTCTGATAATATGCCTGCTCCAGATACTCTTCCCTATGTCATGGTC
GATGGTCCTTATGGATCTGCATCTGAAGATGTGTTTGATTACGAAGCTGCTGTTCTCGTTGGTGCTGGCATTGGTGTCACTCCCTTTGCCTCAATTCTCAAGACAATCTGGTTTCGCATC
AACAACCCTACTCGTGCCGTACCACTTAAAAAGGTTTATTTCTTTTGGATCTGCAGAGACAAGGATGCTTTCGAGTGGTTCCAAGATTTACTTTCCACAATTGAAGATGAAAACATTTCA
AATTTCCTGGAAATCCACACTTATTTGACACAGAAACTCAAAATATTTGAAGTCAAAAACATTGTCATCAATGACGGTGAGGATGGCAGAGATGCGATTACCGGACTAAAGTCTCGTACA
CAATATGGTCGTCCCAACTGGGACCAAATCTTTGAAGCTCTGCGAGTAAAGCATCGAGCCACAGACATTGGTGTCTTTTTCTGTGGTCCCAAAGTATTATCTCGGACTCTCCATCACACA
TGCAACAAATGGACCGAAGCTACTGAAGATGGAACTCGGTTCTACTATGGCAAAGAGAATTTTTAA

Retrieve as FASTA