Entry information : BdeNOx03
Entry ID 6772
Creation 2009-05-10 (Christophe Dunand)
Last sequence changes 2009-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: BdeNOx03
Name BdeNOx03
Class Ancestral NADPH oxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium
Organism Batrachochytrium dendrobatidis    [TaxId: 109871 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdeNOx03
start..stop
S start..stop
LbraFRe01 118 4e-28 112..453 438..766
PcarNOx01 114 3e-27 165..535 132..559
PcNOx01 112 1e-26 181..535 155..559
LbiNOx01 111 3e-26 181..535 155..559
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 638666..638774 109 N° 2 638027..638534 508 N° 3 637206..637897 692 N° 4 636938..637138 201
N° 5 636711..636814 104  
complement(join(636711..636814,636938..637138,637206..637897,638027..638534,6386 66..638774))


exon

Literature and cross-references BdeNOx03
DNA ref. JGI genome:   scaffold_10 (638774..636711)
mRNA ref. JGI transcript:   90468
Protein sequence: BdeNOx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   537
PWM (Da):   %s   59646.29 Transmb domain:   %s   o15-37i58-80o95-114i127-149o169-191i198-220o
PI (pH):   %s   8.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLYNKSHLEAATVYALLVSLLVAIGILPWKRLFSGNANNAFLRLCNTCSLSTMPVWPYYSLPDIVLVVVYIVITALFSVTTISTLDDIDFPRFGYLALANLSVLTLLPLRNSPLSAILGISYERCLLFHALLGVVACLCSLFHGSLYLYMWGSASFLVESINSRAMIPYGLAAGSLFGLVFLTSAIPLVRRISFELFYWIHILSYPTVLVLLYFHTAQSPQFFIPGAVLYGLDRILRIVRALRPANIVDSCAVDNDMIRLTLFQPSFLGKMEKARAGQFVFIKIPDITPYEWHPFSIISPEIDFAAKNQQETAQSIELLEANSEIGSRLSDDSTPSQRETLKPELCELAIRKKGFFTKELHQFISSRRALSVFVDGPYGRAFDGVMDRDTVLLVAGGIGITPLLSILRTIMHRNQHALTGDRKQVGLVWVTRNDHFNWFTAELTKAVSCGIQVHLHATCTYQELTQKTRSLPASVEYCKPDILSLMQGLQHRPNHNVSVAVCGPQSLVLSVEQAARRATSSDGMFVVFSETFSL

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTACTGTATAACAAGAGTCATTTAGAAGCTGCAACTGTTTATGCTCTGCTAGTCAGTCTTTTAGTGGCCATTGGCATTCTACCATGGAAACGGCTTTTTTCAGGTATATTCCAC
TGCATCAAATATAAAGTGACAGCAAAGTCTTTGCAGCAAGCCTTGCAAATGCAGTTGAATAGACTTCCGAATTGAGCCGTGTGCATCTGATGATACTGTACTAACTTTTTACTTGGATAG

GCAATGCAAACAATGCATTTTTGCGATTATGCAACACATGCTCGCTATCGACTATGCCTGTATGGCCATACTATAGTTTGCCAGATATAGTGTTGGTGGTGGTCTATATTGTTATTACTG
CTCTGTTTTCCGTTACAACTATCAGTACATTGGATGACATTGATTTTCCTCGATTTGGATATCTGGCTCTTGCTAACCTATCAGTACTGACTCTGCTGCCACTTCGCAACTCTCCTCTGA
GTGCTATTTTGGGAATTTCCTATGAAAGATGCTTGCTGTTTCATGCCCTGCTTGGGGTTGTTGCATGTTTATGTTCTCTGTTCCATGGATCATTGTATCTATACATGTGGGGTTCGGCTT
CTTTTCTAGTCGAGTCAATCAACTCTCGAGCTATGATCCCATATGGTTTAGCAGCAGGGAGTTTATTTGGACTAGTATTCTTGACCAGTGCCATTCCGCTAGTTCGTCGTATTTCATTTG
AGTTGTTCTACTGGATCCATATTTTGAG
GTAATGTATTGTCTGCAACTCGACTTTTTTTGATGGTTGGTCTTGGTAGACTGACGAGGTTATAGTCAACTCACATTTCATTGACCTATTTG
TTCTGCAATCTTTATGGGTATATATTGTCTTTTAAAGCTATCCTACAGTCTTGGTTTTGCTCTACTTTCATACTGCTCAAAGTCCACAGTTTTTTATACCCGGAGCTGTTCTGTATGGAC
TTGATCGGATTTTACGAATTGTACGAGCACTTCGACCAGCCAACATTGTGGATTCGTGTGCTGTCGATAATGATATGATCCGCCTGACACTCTTTCAGCCATCGTTTTTAGGAAAGATGG
AAAAGGCAAGGGCTGGACAGTTTGTGTTTATCAAGATTCCAGATATAACTCCATATGAGTGGCATCCGTTCAGTATAATCTCGCCCGAGATTGATTTTGCAGCTAAAAATCAGCAGGAAA
CTGCACAGTCGATTGAACTTTTGGAGGCCAACAGTGAGATAGGCTCACGGTTGTCCGATGATTCTACACCGTCACAGCGAGAAACTCTCAAGCCAGAGTTGTGTGAGCTTGCTATTCGAA
AAAAAGGGTTTTTCACCAAAGAGTTGCATCAGTTCATTAGTAGTAGGAGAGCATTGAGTGTGTTTGTAGATGGACCATATGGACGAGCGTTTGATGGGGTCATGGATCGAGATACGGTTT
TACTTGTTGCTGGTGGTATTGGAATTACACCGTTACTGTCTATTTTGAGAACCATCATGCATCGTAATCAACATGCATTAACTGGTGATCGCAAGCAAGTTGGGCTGGTTTGGGTTACAC
GCAATCCAG
GTAATATAGACTTGACATGTATCGATTAGACTAGTACTTGACATTTTACAATGTATTTTAAAACCAGATCATTTTAACTGGTTTACCGCGGAGCTGACCAAGGCAGTTTCA
TGTGGTATTCAAGTTCATTTACATGCAACATGCACGTATCAAGAACTCACACAAAAAACAAGAAGCTTACCAGCTTCTGTAGAATATTGTAAACCAGATATTTTGAGCCTTATGCAAGGA
CTGCAACATAGGCCCAACCACAACGTATCAGTTGCAG
GTAAGAAGTGCAAGGTTTTCAGATATCAAGAGTTTTATAGATGGGATTGTACTGACAGCAACTTTATTTGATACAACTATGAC
GGATAAATCCAAACCCTTGACACCTGCTGTTTTCTATTAGTGTGTGGACCACAGTCTCTTGTTCTGTCAGTAGAACAGGCAGCACGTAGAGCCACCAGTTCCGATGGCATGTTTGTTGTG
TTTTCAGAGACCTTTTCTCTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTACTGTATAACAAGAGTCATTTAGAAGCTGCAACTGTTTATGCTCTGCTAGTCAGTCTTTTAGTGGCCATTGGCATTCTACCATGGAAACGGCTTTTTTCAGGCAATGCAAAC
AATGCATTTTTGCGATTATGCAACACATGCTCGCTATCGACTATGCCTGTATGGCCATACTATAGTTTGCCAGATATAGTGTTGGTGGTGGTCTATATTGTTATTACTGCTCTGTTTTCC
GTTACAACTATCAGTACATTGGATGACATTGATTTTCCTCGATTTGGATATCTGGCTCTTGCTAACCTATCAGTACTGACTCTGCTGCCACTTCGCAACTCTCCTCTGAGTGCTATTTTG
GGAATTTCCTATGAAAGATGCTTGCTGTTTCATGCCCTGCTTGGGGTTGTTGCATGTTTATGTTCTCTGTTCCATGGATCATTGTATCTATACATGTGGGGTTCGGCTTCTTTTCTAGTC
GAGTCAATCAACTCTCGAGCTATGATCCCATATGGTTTAGCAGCAGGGAGTTTATTTGGACTAGTATTCTTGACCAGTGCCATTCCGCTAGTTCGTCGTATTTCATTTGAGTTGTTCTAC
TGGATCCATATTTTGAG
CTATCCTACAGTCTTGGTTTTGCTCTACTTTCATACTGCTCAAAGTCCACAGTTTTTTATACCCGGAGCTGTTCTGTATGGACTTGATCGGATTTTACGAATT
GTACGAGCACTTCGACCAGCCAACATTGTGGATTCGTGTGCTGTCGATAATGATATGATCCGCCTGACACTCTTTCAGCCATCGTTTTTAGGAAAGATGGAAAAGGCAAGGGCTGGACAG
TTTGTGTTTATCAAGATTCCAGATATAACTCCATATGAGTGGCATCCGTTCAGTATAATCTCGCCCGAGATTGATTTTGCAGCTAAAAATCAGCAGGAAACTGCACAGTCGATTGAACTT
TTGGAGGCCAACAGTGAGATAGGCTCACGGTTGTCCGATGATTCTACACCGTCACAGCGAGAAACTCTCAAGCCAGAGTTGTGTGAGCTTGCTATTCGAAAAAAAGGGTTTTTCACCAAA
GAGTTGCATCAGTTCATTAGTAGTAGGAGAGCATTGAGTGTGTTTGTAGATGGACCATATGGACGAGCGTTTGATGGGGTCATGGATCGAGATACGGTTTTACTTGTTGCTGGTGGTATT
GGAATTACACCGTTACTGTCTATTTTGAGAACCATCATGCATCGTAATCAACATGCATTAACTGGTGATCGCAAGCAAGTTGGGCTGGTTTGGGTTACACGCAATCCAG
ATCATTTTAAC
TGGTTTACCGCGGAGCTGACCAAGGCAGTTTCATGTGGTATTCAAGTTCATTTACATGCAACATGCACGTATCAAGAACTCACACAAAAAACAAGAAGCTTACCAGCTTCTGTAGAATAT
TGTAAACCAGATATTTTGAGCCTTATGCAAGGACTGCAACATAGGCCCAACCACAACGTATCAGTTGCAG
TGTGTGGACCACAGTCTCTTGTTCTGTCAGTAGAACAGGCAGCACGTAGA
GCCACCAGTTCCGATGGCATGTTTGTTGTGTTTTCAGAGACCTTTTCTCTGTAG

Retrieve as FASTA