Entry information : BdeFRe01
Entry ID 6773
Creation 2009-05-10 (Christophe Dunand)
Last sequence changes 2009-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: BdeFRe01
Name BdeFRe01
Class Ferric Reductase    [Orthogroup: FRe001]
Taxonomy Eukaryota Fungi Chytridiomycota Chytridiomycetes Batrachochytrium
Organism Batrachochytrium dendrobatidis    [TaxId: 109871 ]
Cellular localisation N/D
Tissue type N/D
Inducer Abscissic acid treatment
Repressor N/D
Best BLASTp hits
Perox score E-value BdeFRe01
start..stop
S start..stop
LeFRO05 125 2e-30 219..532 184..504
LeFRO04 115 8e-27 220..542 216..560
LeFRO02 102 8e-23 224..467 209..450
LeFRO01 100 1e-22 283..467 1..183
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 369516..370077 562 N° 2 370203..371851 1649  
join(369516..370077,370203..371851)


exon

Literature and cross-references BdeFRe01
DNA ref. JGI genome:   scaffold_3 (369516..371851)
mRNA ref. JGI transcript:   87228
Protein sequence: BdeFRe01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   737
PWM (Da):   %s   82501.31 Transmb domain:   %s   i21-43o63-82i143-165o180-202i229-251o271-289i296-318o451-473i571-593o624-646i
PI (pH):   %s   9.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVIAASPRKPILSPTVVRLAARILATLAMLVALVASYALASMVEGGKLRWSSSIMVVDRFDQWILGFALLPMFIATLSTFFSDPNTPDSIVTGRNDEYTISADGRSSTAHSTPLHCSGFWNPRFKFLGKYSTLFKPWSQGDIMITCLLVISNILWWIAPVITRLYLKPSKTLSTPRGMLARFAIWAAMAGLWNAAMAIVFVVRENHITKNIVGKDAGQFHRGLRYHIALGYTSFVQITFHGTYYLTIMVIDGAFPNEILPTLSDTGYSNFFGFLAWLSLMLMALTSIFKVRRANYRIFYWTHQLYTCFLLFAFMHQTRTWYPVMASLVYFIFDRLLPRLKTQRTTSALLTRVSPSVVRLDIAILQTYADSCTYSPGSWVNILVPSISHFNWHPFSISSSHHLTPRTVTLYIKARGAWTTQLHASSTGLGVMVPIKMDGFFGSRNNSYLSYQHLVVVGAGTGIATIIPYIYSYAQHTLGKITVFWLARTAVEACAYRSLLEALSDPNSPLAGRVDLHLHLTREQDSRVSTKHDHRIGSGFNGNPNFASTLSKSVGYEQSSTTTKPSYRLSAIFLSIIVFSAAAVGYVIGRTYVPAYNADECNADEAYTLVGLSHFMCWYYPQWAPTGFACLFAAISGLAFVWMVSLMKQTDAAVSNVEPIDVTPASFEWFKERFTWVAHRPNFAYELESVFNFYNSIENQSNIKIAVIAGGPERMVRDIENVVIDHGQAFFRESWK

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCTGCCAGTCCTCGCAAACCTATTTTATCACCAACTGTTGTTCGTCTAGCCGCCAGAATACTGGCTACGTTGGCCATGCTCGTGGCATTGGTGGCTTCTTACGCTTTA
GCATCAATGGTTGAAGGCGGAAAATTGCGCTGGAGTAGTTCCATTATGGTTGTGGATCGATTTGACCAATGGATTCTTGGATTCGCACTGTTACCCATGTTCATTGCCACACTATCTACC
TTTTTTAGCGATCCAAATACACCAGATTCTATAGTCACGGGAAGAAACGACGAGTACACAATATCTGCTGATGGTCGGTCTTCCACCGCCCACTCCACTCCACTTCATTGCTCTGGTTTC
TGGAATCCCCGTTTCAAATTCCTTGGTAAATACAGCACTCTTTTCAAACCATGGTCTCAAGGAGATATTATGATTACCTGTTTGCTTGTCATCTCCAATATTCTATGGTGGATTGCTCCT
GTGATTACTCGTCTGTATCTAAAACCCTCAAAAACACTTTCCACTCCCCGCGGCATGCTTGCTCGATTTGCAATTTGGGCCG
GTAAGTTTAAACATTTCACAAGCATATTCACCGTGTAG
CTGGATTTCAAGCTAGTGCATGTCCCTTTTCAACAGTACTAATTAAAAACTTGAACTGCTGCATACCTCTGTGATAAACATACATAGCCATGGCTGGTTTGTGGAATGCTGCAATGGCTA
TTGTATTTGTTGTTCGTGAGAATCATATTACCAAAAACATTGTTGGCAAGGATGCTGGCCAGTTTCATCGTGGTCTCCGATATCACATTGCCTTGGGATACACGAGCTTTGTCCAAATTA
CCTTTCATGGCACATATTACCTTACTATCATGGTGATAGATGGTGCTTTTCCCAATGAGATACTGCCAACTCTCAGTGACACTGGCTATTCCAACTTTTTTGGATTTCTAGCTTGGCTTT
CTTTGATGCTTATGGCTCTGACCTCTATCTTTAAAGTGCGTCGTGCCAACTACCGCATCTTTTATTGGACGCATCAGCTTTATACCTGTTTCCTGCTTTTTGCGTTCATGCACCAAACTA
GAACTTGGTATCCAGTTATGGCTTCACTCGTGTACTTTATCTTTGATCGGCTTTTACCTCGCCTTAAAACTCAGCGCACCACATCTGCTCTGCTCACTCGTGTTTCTCCGTCAGTAGTTC
GGCTGGATATTGCCATCTTGCAAACCTATGCAGATTCTTGTACATATTCTCCTGGCAGTTGGGTCAATATACTTGTTCCCTCAATTTCCCATTTCAATTGGCACCCATTTTCTATCTCCT
CCAGTCATCATCTTACTCCTCGCACCGTTACTCTATATATCAAGGCTCGAGGTGCATGGACTACGCAGCTGCACGCTTCGTCAACCGGCTTAGGTGTCATGGTTCCAATTAAGATGGACG
GATTTTTTGGGTCGCGCAACAACAGCTACTTGTCCTACCAACACCTTGTTGTTGTGGGTGCTGGAACTGGTATTGCTACTATAATCCCCTACATATACAGCTATGCCCAACATACTCTGG
GGAAAATCACGGTATTTTGGTTGGCTCGCACTGCTGTTGAAGCGTGCGCATATCGTTCTCTACTTGAAGCTCTCTCTGATCCCAATTCACCACTTGCTGGTCGTGTCGACTTGCATCTGC
ATTTGACTCGCGAGCAGGATTCTCGTGTATCTACTAAACACGACCATCGCATTGGATCCGGATTTAATGGAAACCCGAACTTTGCTTCCACCCTTTCTAAATCTGTTGGCTATGAACAAT
CAAGCACAACTACCAAACCATCCTACCGTTTGTCCGCCATTTTTCTTTCCATAATTGTATTTAGTGCTGCAGCTGTGGGATACGTTATTGGACGTACCTATGTTCCCGCATACAATGCCG
ATGAATGCAATGCCGACGAAGCATACACGCTTGTTGGACTTTCTCACTTTATGTGTTGGTATTATCCCCAATGGGCACCTACTGGATTTGCCTGTCTATTTGCTGCTATCAGTGGTCTTG
CCTTTGTATGGATGGTCTCACTAATGAAGCAAACTGATGCTGCTGTTTCAAACGTGGAGCCTATTGATGTCACTCCCGCATCTTTCGAGTGGTTCAAGGAACGCTTTACCTGGGTCGCTC
ATCGGCCAAACTTTGCCTATGAGCTTGAATCAGTGTTCAACTTTTATAATAGTATCGAGAATCAGTCTAACATTAAGATTGCTGTGATTGCCGGAGGTCCTGAGCGTATGGTTCGTGATA
TTGAAAATGTGGTGATTGATCACGGTCAAGCCTTTTTCCGCGAGTCTTGGAAAATG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTTATTGCTGCCAGTCCTCGCAAACCTATTTTATCACCAACTGTTGTTCGTCTAGCCGCCAGAATACTGGCTACGTTGGCCATGCTCGTGGCATTGGTGGCTTCTTACGCTTTA
GCATCAATGGTTGAAGGCGGAAAATTGCGCTGGAGTAGTTCCATTATGGTTGTGGATCGATTTGACCAATGGATTCTTGGATTCGCACTGTTACCCATGTTCATTGCCACACTATCTACC
TTTTTTAGCGATCCAAATACACCAGATTCTATAGTCACGGGAAGAAACGACGAGTACACAATATCTGCTGATGGTCGGTCTTCCACCGCCCACTCCACTCCACTTCATTGCTCTGGTTTC
TGGAATCCCCGTTTCAAATTCCTTGGTAAATACAGCACTCTTTTCAAACCATGGTCTCAAGGAGATATTATGATTACCTGTTTGCTTGTCATCTCCAATATTCTATGGTGGATTGCTCCT
GTGATTACTCGTCTGTATCTAAAACCCTCAAAAACACTTTCCACTCCCCGCGGCATGCTTGCTCGATTTGCAATTTGGGCCG
CCATGGCTGGTTTGTGGAATGCTGCAATGGCTATTGTA
TTTGTTGTTCGTGAGAATCATATTACCAAAAACATTGTTGGCAAGGATGCTGGCCAGTTTCATCGTGGTCTCCGATATCACATTGCCTTGGGATACACGAGCTTTGTCCAAATTACCTTT
CATGGCACATATTACCTTACTATCATGGTGATAGATGGTGCTTTTCCCAATGAGATACTGCCAACTCTCAGTGACACTGGCTATTCCAACTTTTTTGGATTTCTAGCTTGGCTTTCTTTG
ATGCTTATGGCTCTGACCTCTATCTTTAAAGTGCGTCGTGCCAACTACCGCATCTTTTATTGGACGCATCAGCTTTATACCTGTTTCCTGCTTTTTGCGTTCATGCACCAAACTAGAACT
TGGTATCCAGTTATGGCTTCACTCGTGTACTTTATCTTTGATCGGCTTTTACCTCGCCTTAAAACTCAGCGCACCACATCTGCTCTGCTCACTCGTGTTTCTCCGTCAGTAGTTCGGCTG
GATATTGCCATCTTGCAAACCTATGCAGATTCTTGTACATATTCTCCTGGCAGTTGGGTCAATATACTTGTTCCCTCAATTTCCCATTTCAATTGGCACCCATTTTCTATCTCCTCCAGT
CATCATCTTACTCCTCGCACCGTTACTCTATATATCAAGGCTCGAGGTGCATGGACTACGCAGCTGCACGCTTCGTCAACCGGCTTAGGTGTCATGGTTCCAATTAAGATGGACGGATTT
TTTGGGTCGCGCAACAACAGCTACTTGTCCTACCAACACCTTGTTGTTGTGGGTGCTGGAACTGGTATTGCTACTATAATCCCCTACATATACAGCTATGCCCAACATACTCTGGGGAAA
ATCACGGTATTTTGGTTGGCTCGCACTGCTGTTGAAGCGTGCGCATATCGTTCTCTACTTGAAGCTCTCTCTGATCCCAATTCACCACTTGCTGGTCGTGTCGACTTGCATCTGCATTTG
ACTCGCGAGCAGGATTCTCGTGTATCTACTAAACACGACCATCGCATTGGATCCGGATTTAATGGAAACCCGAACTTTGCTTCCACCCTTTCTAAATCTGTTGGCTATGAACAATCAAGC
ACAACTACCAAACCATCCTACCGTTTGTCCGCCATTTTTCTTTCCATAATTGTATTTAGTGCTGCAGCTGTGGGATACGTTATTGGACGTACCTATGTTCCCGCATACAATGCCGATGAA
TGCAATGCCGACGAAGCATACACGCTTGTTGGACTTTCTCACTTTATGTGTTGGTATTATCCCCAATGGGCACCTACTGGATTTGCCTGTCTATTTGCTGCTATCAGTGGTCTTGCCTTT
GTATGGATGGTCTCACTAATGAAGCAAACTGATGCTGCTGTTTCAAACGTGGAGCCTATTGATGTCACTCCCGCATCTTTCGAGTGGTTCAAGGAACGCTTTACCTGGGTCGCTCATCGG
CCAAACTTTGCCTATGAGCTTGAATCAGTGTTCAACTTTTATAATAGTATCGAGAATCAGTCTAACATTAAGATTGCTGTGATTGCCGGAGGTCCTGAGCGTATGGTTCGTGATATTGAA
AATGTGGTGATTGATCACGGTCAAGCCTTTTTCCGCGAGTCTTGGAAAATG

Retrieve as FASTA