Entry information : LbiDyPrx02
Entry ID 6775
Creation 2009-05-10 (Christophe Dunand)
Last sequence changes 2009-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: LbiDyPrx02
Name LbiDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Laccaria
Organism Laccaria bicolor    [TaxId: 29883 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LbiDyPrx02
start..stop
S start..stop
SlutDyPrx01 639 0 10..885 12..916
SbreDyPrx01 634 0 10..885 12..916
PplDyPrx01 437 4e-142 9..553 11..548
BaDyPrx07 415 2e-134 6..549 8..496
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1149009..1149200 192 N° 2 1148787..1148986 200 N° 3 1148649..1148761 113 N° 4 1148440..1148596 157
N° 5 1148083..1148389 307 N° 6 1147790..1148020 231 N° 7 1147265..1147740 476 N° 8 1146803..1147212 410
N° 9 1146697..1146749 53 N° 10 1146606..1146647 42 N° 11 1146504..1146544 41 N° 12 1146141..1146450 310
N° 13 1146000..1146086 87 N° 14 1145907..1145948 42  
complement(join(1145907..1145948,1146000..1146086,1146141..1146450,1146504..1146 544,1146606..1146647,1146697..1146749,1146803..1147212,1147265..1147740,1147790. .1148020,1148083..1148389,1148440..1148596,1148649..1148761,1148787..1148986,114 9009..1149200))


exon

Literature and cross-references LbiDyPrx02
DNA ref. JGI genome:   LG_3 (1149200..1145907)
EST ref. GenBank:   EX782119.1 [3' end]
Protein sequence: LbiDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   886
PWM (Da):   %s   96946.91  
PI (pH):   %s   5.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVSIHPSLKHLSKRSRLPAISVGRKRGGPAVPDAAALPDPTNVQGDVYLGIPKVRIFLNDSLSGCQAFIFFIIDDVSKFRQALQTYHPTSSADVTKALQAISTSKDSGGGDVDIIMTQIAFSQLGLKNIGFDAGSMLHDRKFLGDQGPWDSVFDPATIHGVIMVCASQDKVDSGVQTIKDTFGASWEIKQTLSGNARPGKYKGKEHFGYQDGVSQPSLRGLTTPHRGQLEADPGVLILGYPGDPLVDNPLGPQRPDWARDGSFMVFRKLEQDVKGWNNFVAKSAKYWQDFTPVPDEVQPPFKDDDEKANFVGAALVGRWKGAPIQLAHFRDDPSLATEDNANNFDYSVPGVVLPTNRYCPFNSHTRKTAPRNLDPYLTRKYLESSLIARTGIPYGKEIDVAPTEQRGLLFVCYQSALDNGFVRQTVGFSSNDFFPTTDVLPQNHGKLSVQVYETLLDANTLGQDPITGSNPKVTVVDDAIALNKKPESGQVTLAVVDSNTSEKYLVTGFPQQVNDTVDKYTPDFFVTSHGGEYFFVPSIPTLTAWSKAPTTTKSKLDIMFLIDATGSMDPYIKQASASIGTIYDNVLRNGSWSKDDIRVGLVAFRDHPQKKATTFLTQKYDFTSDMSKVSDNLDALEAKDGEDYPEASEDALEDALEADWNDDAVMVTVLITDSTPHATGESHDYFKDGCPQNDPVDIADRMADLGIVLYVLGCEPKLSAKTAGGIDFYTGITAKGGKLLTLNTANIDQLGDIIVGMASDTSDSELAVSENTSAILKRKGDKISDIANDLHKQLTAKGVKHWKFTMSNVYSFNSDAKDNVKVWFKAKKLDQTVRDKIKSVKGNRVNSDYRKGERPTVTLEKEAISYDQVEALVTKCLRRSK

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGTCTCAATCCATCCAAGCCTGAAGCATCTCTCAAAGCGGTCGAGACTACCAGCGATATCGGTGGGGCGCAAGAGAGGGGGCCCCGCTGTCCCAGATGCTGCTGCTCTCCCAGAT
CCTACGAACGTTCAAGGAGACGTCTACCTGGGGATTCCGAAAGTTCGGATTTTTCTAAATGATTCTTTGTCA
GTAATAACACCTGACTTTTTAGGGCTGTCAAGCATTCATCTTCTTCAT
CATCGACGATGTCTCCAAATTTCGACAAGCTCTACAGACCTACCACCCAACATCTTCTGCTGACGTAACGAAAGCGCTTCAAGCTATATCGACCTCAAAGGATTCGGGTGGCGGGGACGT
TGATATTATCATGACACAAATTGCGTTCAGCCAGCTCGGCCTAAAAAACATTGG
GTGTTGGAAAGACCGGAGACACAAGATTTGATGCTGGCTCGATGCTCCACGACCGGAAGTTTTTGG
GTGATCAAGGCCCATGGGACTCTGTCTTTGACCCCGCGACTATCCATGGCGTGATTATGGTTTGCGCCAAAA
GTACGAGCCACTTGATATGCTATTGAATTGGTCTCACTGAAAGTCTCT
CAAGGTCAAGACAAGGTGGACTCGGGTGTGCAAACGATCAAGGACACGTTTGGTGCATCGTGGGAGATCAAGCAAACCTTGTCAGGCAATGCTCGCCCTGGCAAATACAAGGGAAAGGAA
CACTTCGGATATCAGGACGGTGTATCCCAGCCATCGTTGAG
GTGCAGCACCTTTCAAGAATATTTGACTGGTCAATATTGACTGTGTTCAGAGGCTTAACCACCCCTCATCGTGGACAAC
TAGAGGCTGATCCGGGTGTCCTTATCTTGGGCTACCCGGGTGATCCGCTTGTGGACAATCCGTTAGGGCCCCAGCGCCCTGATTGGGCTCGTGATGGCTCCTTCATGGTGTTTCGCAAAC
TTGAGCAAGACGTTAAGGGCTGGAACAACTTTGTGGCTAAAAGCGCAAAGTATTGGCAAGATTTCACGCCAGTCCCAGATGAAGTTCAGCCTCCTTTCAAGGACGACGATGAGAAGGCAA
ATTTCGTTGGCGCTGCCTTAGTTGGCAGATGGAAGTCT
GTATGTCATTCTACATCCTCGCACTCACTTTCATGTGACCACAAGCTAACCTTTGAGTGCAGGGCGCCCCAATTCAATTGGC
GCATTTCCGAGATGATCCGTCTCTCGCCACCGAGGACAACGCCAATAACTTCGATTATTCCGTGCCCGGCGTTGTTCTCCCTACAAATAGATACTGCCCTTTCAACTCTCATACTCGCAA
AACTGCGCCTAGAAATCTTGACCCGTATCTGACCAGGAAATATCTGGAATCGTCTCTTATCGCGCGCACTGGGATCCCATACGGCAAAGAG
GTAACTTTCCTCTGCCTTTCATTGTGAAA
TTCTTACAACAACCCATTAGATTGACGTGGCACCAACTGAACAACGAGGGCTTCTCTTCGTGTGCTATCAGTCCGCCCTCGACAATGGTTTTGTCCGCCAGACTGTTGGCTTTTCGTCCA
ATGACTTTTTCCCTACCACTGACGTATTGCCTCAAAACCACGGTAAACTTTCAGTTCAAGTGTATGAGACATTGCTTGATGCGAACACCTTAGGCCAAGATCCCATCACGGGTAGCAACC
CAAAGGTGACGGTCGTAGACGATGCCATTGCTCTCAACAAAAAGCCCGAATCTGGACAAGTTACGCTGGCGGTTGTAGATTCCAATACCTCTGAAAAGTATCTCGTGACGGGATTCCCTC
AGCAAGTTAACGACACAGTCGACAAATATACCCCAGACTTTTTTGTGACATCTCATGGGGGAGAGTACTTCTTCGTCCCTTCCATTCCAACCCTGACAGCTTGGTCGAAAGCTCCGACAA
CGACGAAATCGAAGCT
GTAAGCTCCTAAGTTCTTCATCTAGGCTTATCAGAACTGATTGAAAAATCAGCGATATCATGTTCCTTATTGACGCCACAGGAAGCATGGATCCTTACATCAAG
CAAGCCAGTGCTTCAATTGGCACCATATACGATAATGTACTTAGGAATGGCAGCTGGAGTAAGGACGATATCCGCGTTGGCCTTGTCGCATTCCGTGATCATCCGCAGAAAAAAGCGACG
ACGTTCCTTACGCAGAAGTATGATTTCACGTCCGATATGTCTAAGGTTTCAGACAACCTAGATGCTCTAGAGGCCAAGGATGGCGAGGACTATCCTGAGGCCTCTGAAGATGCGTTGGAG
GACGCCTTGGAAGCGGATTGGAACGACGATGCAGTCATGGTCACGGTTTTGATTACTGATTCGACCCCGCATGCCACTGGAGAATCACATGATTACTTCAAGGACGGATGCCCTGACC
GT
GAGTCCTCTTTACTGACCAACAGTTATGGTGACGAACTGACACAACATCAGAGAATGACCCCGTCGATATAGCAGACCGAATGGCTGACTTGGGGATTGTTCTAGTATGTCCTCCTCAAC
CGTCTTCACTTCTAATTCACAATCATTGTCTAGTACGTTCTCGGGTGTGAGCCAAAGCTTAGTGCGAAGACTGCTGTAAGCTCACGGCCTTGATCGTCATATCGATTTTTTATGAACTGA
AATTCAACGTGATTAGGGTGGAATTGATTTTTACACCGGCATAACTGCAAAGACGGGGTTAGTTGATTTTTTTTGGAATCGCCCCGCGGGGTGGCTGATAACGAACTCAGGGGGAAGCTG
TTAACCCTCAACACGGCAAATATAGACCAACTGGGCGACATCATAGTAGGAATGGCCTCGGATACGTCTGACAGCGAATTGGCCGTAAGCGAGAACACATCAGCGATTCTGAAGCGAAAG
GGCGACAAAATCAGCGACATCGCGAATGATTTGCATAAGCAACTGACTGCGAAAGGGGTCAAACACTGGAAGTTTACGATGAGCAACGTTTATTCATTCAATAGCGATGCCAAAGACAAT
GTGAAGGTGTGGTTCAAAGCGAAGAAGCTTGACCAAACTGTTCGAGACAAGATCAAGAGT
GTTGGTTTTTTGTCAGGTTATTTCTCGGGAATCTTTTGCTGAATTTCAATCTAGGTAAAG
GGCAATCGCGTCAACTCGGACTACCGCAAGGGAGAACGACCTACGGTTACGTTAGAAAAGGAAGCCATCAGTTATGACCAG
GTAACGCACACTGCTTGTTGTCTCCAATAATTACTGACG
GGTCAATCTAAGGTGGAAGCTCTTGTGACGAAGTGCTTGCGACGGAGCAAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAGTCTCAATCCATCCAAGCCTGAAGCATCTCTCAAAGCGGTCGAGACTACCAGCGATATCGGTGGGGCGCAAGAGAGGGGGCCCCGCTGTCCCAGATGCTGCTGCTCTCCCAGAT
CCTACGAACGTTCAAGGAGACGTCTACCTGGGGATTCCGAAAGTTCGGATTTTTCTAAATGATTCTTTGTCA
GGCTGTCAAGCATTCATCTTCTTCATCATCGACGATGTCTCCAAATTT
CGACAAGCTCTACAGACCTACCACCCAACATCTTCTGCTGACGTAACGAAAGCGCTTCAAGCTATATCGACCTCAAAGGATTCGGGTGGCGGGGACGTTGATATTATCATGACACAAATT
GCGTTCAGCCAGCTCGGCCTAAAAAACATTGG
ATTTGATGCTGGCTCGATGCTCCACGACCGGAAGTTTTTGGGTGATCAAGGCCCATGGGACTCTGTCTTTGACCCCGCGACTATCCAT
GGCGTGATTATGGTTTGCGCCAAAA
GTCAAGACAAGGTGGACTCGGGTGTGCAAACGATCAAGGACACGTTTGGTGCATCGTGGGAGATCAAGCAAACCTTGTCAGGCAATGCTCGCCCT
GGCAAATACAAGGGAAAGGAACACTTCGGATATCAGGACGGTGTATCCCAGCCATCGTTGAG
AGGCTTAACCACCCCTCATCGTGGACAACTAGAGGCTGATCCGGGTGTCCTTATCTTG
GGCTACCCGGGTGATCCGCTTGTGGACAATCCGTTAGGGCCCCAGCGCCCTGATTGGGCTCGTGATGGCTCCTTCATGGTGTTTCGCAAACTTGAGCAAGACGTTAAGGGCTGGAACAAC
TTTGTGGCTAAAAGCGCAAAGTATTGGCAAGATTTCACGCCAGTCCCAGATGAAGTTCAGCCTCCTTTCAAGGACGACGATGAGAAGGCAAATTTCGTTGGCGCTGCCTTAGTTGGCAGA
TGGAAGTCT
GGCGCCCCAATTCAATTGGCGCATTTCCGAGATGATCCGTCTCTCGCCACCGAGGACAACGCCAATAACTTCGATTATTCCGTGCCCGGCGTTGTTCTCCCTACAAATAGA
TACTGCCCTTTCAACTCTCATACTCGCAAAACTGCGCCTAGAAATCTTGACCCGTATCTGACCAGGAAATATCTGGAATCGTCTCTTATCGCGCGCACTGGGATCCCATACGGCAAAGAG
ATTGACGTGGCACCAACTGAACAACGAGGGCTTCTCTTCGTGTGCTATCAGTCCGCCCTCGACAATGGTTTTGTCCGCCAGACTGTTGGCTTTTCGTCCAATGACTTTTTCCCTACCACT
GACGTATTGCCTCAAAACCACGGTAAACTTTCAGTTCAAGTGTATGAGACATTGCTTGATGCGAACACCTTAGGCCAAGATCCCATCACGGGTAGCAACCCAAAGGTGACGGTCGTAGAC
GATGCCATTGCTCTCAACAAAAAGCCCGAATCTGGACAAGTTACGCTGGCGGTTGTAGATTCCAATACCTCTGAAAAGTATCTCGTGACGGGATTCCCTCAGCAAGTTAACGACACAGTC
GACAAATATACCCCAGACTTTTTTGTGACATCTCATGGGGGAGAGTACTTCTTCGTCCCTTCCATTCCAACCCTGACAGCTTGGTCGAAAGCTCCGACAACGACGAAATCGAAGCT
CGAT
ATCATGTTCCTTATTGACGCCACAGGAAGCATGGATCCTTACATCAAGCAAGCCAGTGCTTCAATTGGCACCATATACGATAATGTACTTAGGAATGGCAGCTGGAGTAAGGACGATATC
CGCGTTGGCCTTGTCGCATTCCGTGATCATCCGCAGAAAAAAGCGACGACGTTCCTTACGCAGAAGTATGATTTCACGTCCGATATGTCTAAGGTTTCAGACAACCTAGATGCTCTAGAG
GCCAAGGATGGCGAGGACTATCCTGAGGCCTCTGAAGATGCGTTGGAGGACGCCTTGGAAGCGGATTGGAACGACGATGCAGTCATGGTCACGGTTTTGATTACTGATTCGACCCCGCAT
GCCACTGGAGAATCACATGATTACTTCAAGGACGGATGCCCTGACC
AGAATGACCCCGTCGATATAGCAGACCGAATGGCTGACTTGGGGATTGTTCTATACGTTCTCGGGTGTGAGCCA
AAGCTTAGTGCGAAGACTGCT
GGTGGAATTGATTTTTACACCGGCATAACTGCAAAGACGGGGGGGAAGCTGTTAACCCTCAACACGGCAAATATAGACCAACTGGGCGACATCATAGTA
GGAATGGCCTCGGATACGTCTGACAGCGAATTGGCCGTAAGCGAGAACACATCAGCGATTCTGAAGCGAAAGGGCGACAAAATCAGCGACATCGCGAATGATTTGCATAAGCAACTGACT
GCGAAAGGGGTCAAACACTGGAAGTTTACGATGAGCAACGTTTATTCATTCAATAGCGATGCCAAAGACAATGTGAAGGTGTGGTTCAAAGCGAAGAAGCTTGACCAAACTGTTCGAGAC
AAGATCAAGAGT
GTAAAGGGCAATCGCGTCAACTCGGACTACCGCAAGGGAGAACGACCTACGGTTACGTTAGAAAAGGAAGCCATCAGTTATGACCAGGTGGAAGCTCTTGTGACGAAG
TGCTTGCGACGGAGCAAATAG

Retrieve as FASTA