Entry information : PgrDyPrx02
Entry ID 6778
Creation 2009-05-11 (Christophe Dunand)
Last sequence changes 2009-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: PgrDyPrx02
Name PgrDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Puccinia graminis f. sp. tritici    [TaxId: 56615 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgrDyPrx02
start..stop
S start..stop
PgrDyPrx03 737 0 70..537 33..501
PgrDyPrx04 733 0 70..537 33..500
PgrDyPrx05 733 0 70..537 33..501
PgrDyPrx06 719 0 70..537 20..488
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 788509..788658 150 N° 2 788370..788414 45 N° 3 788303..788316 14 N° 4 787541..788138 598
N° 5 787149..787443 295 N° 6 786962..787076 115 N° 7 786782..786870 89 N° 8 786589..786701 113
N° 9 786371..786493 123 N° 10 786232..786299 68 N° 11 786126..786141 16  
complement(join(786126..786141,786232..786299,786371..786493,786589..786701,7867 82..786870,786962..787076,787149..787443,787541..788138,788303..788316,788370..7 88414,788509..788658))


exon

Literature and cross-references PgrDyPrx02
DNA ref. JGI genome:   supercontig_2_16 (788658..786126)
Protein sequence: PgrDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   541
PWM (Da):   %s   59823.95  
PI (pH):   %s   9.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTDCPSSFTCYILSNVSIAIVVECLTSDLLQRPKFDEQSLLKDINSKTASFARKPYLKGTDIIFPFTFGKVDLKNVQGDVIIGLQKRQEAFWFGTLRSDPSSIEGFRKNLKTHLLPLITTTQGVIDAQKVIDDHQRKQKKGEAKQWLPITHVNLGFAYNGLKKLGLKPEEIPTGRDGVFSKGQKLDAVKNLGDPMIQATKKLNTWSRDFLGEVNTIDFVVLITAPDSNLLNQKLHQVRRMFNGFLSHSFLRQGNVRPGDQYANEHFGFDAISMAKIKGVNARAEDRKAGIVEPGVILLGYPSANGNSTAPDANQAWLKDGSFMAFRELRQLVPEFHHFCDETAKNMKNLNVSGDFIGARIVGRWKSGAPLTLAPKHDNPALSTAQDFDYSDELKQERCPYAAHIRKSNPRNGIQGADPQKTTLPHLMIRNSIPGPELTGEEKYFKRTIENRGLLFVAYQSDIVAGFQFVQAWCNNPSFPPQTALNVSAGLDLLIGQHSDGSPRTAQNITPSVPGGNADPRNTVTAFQPFVVPLGTLLL

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGATTGTCCATCCTCCTTCACTTGCTACATACTCAGCAACGTTTCAATTGCTATCGTTGTTGAATGTTTGACGTCAGATCTCCTCCAGCGACCGAAATTCGATGAGCAATCGCTT
TTGAAAGACATAAATAGCAAGACTGCATCG
GTTTGTTTTCGATGCAGAGTAAATACGAAAAGAGAGAAAAGATGCGAACCCCGACATTTTCCATTAACAACTTGTTTTTGATCGTTCTAC
CCAGTTTGCTAGGAAGCCATACCTCAAAGGCACAGATATCATCTTCCCGGTGCGTTTTGCCTGCTATTTCCACTCCATGATTTTTTTTTTTCACTTTTTCAGTTCACATTTGGCAAGTAT
CTTGACTTGATTCGCCAGTTTCTTCAATTGAATCAAGCGGAATACGACTTGATGTTGGGAAAACAAGACGCATAACTGCCTTTCATGACTGATGTTCCGGTTTTAATCGTTTCCTTGCTG
ACGTATAACTTGTTTTAAATATCATTTTTCTACTTGATAGGGTCGACCTGAAAAACGTCCAAGGCGATGTTATTATTGGTTTGCAGAAACGGCAAGAAGCGTTTTGGTTTGGCACTTTAA
GATCAGATCCAAGTTCAATCGAAGGCTTTCGCAAAAATCTGAAAACCCACTTACTTCCATTAATTACAACGACACAAGGTGTTATTGATGCACAAAAGGTCATAGATGATCATCAACGAA
AACAGAAAAAAGGGGAGGCCAAACAATGGCTTCCGATCACCCACGTTAATTTGGGATTTGCTTATAACGGGTTAAAGAAGTTGGGCTTGAAGCCGGAGGAGATCCCTACCGGCAGGGACG
GGGTATTTTCCAAAGGTCAAAAGCTTGACGCCGTGAAAAACTTGGGAGATCCGATGATTCAAGCAACAAAAAAGTTAAATACCTGGTCTCGCGATTTTTTGGGCGAAGTTAACACGATCG
ATTTCGTCGTCCTGATCACTGCTCCGGACTCGAATTTATTAAATCAAAAACTCCATCAGGTTCGCAGGATGTTCAATGGGTTTTTGTCGCACTCTTTCCTTCGTCAAGGTAATGTCAGGC
CCGGTGATCAGTATGCCAATGAGCATTTCGGATTCCCG
GTTGAGTGTCTTTCTTTCTCTAGTCATTTTCTATTACCCTAGAAAAGGGTTTCACTTGCTCCATTGGTGACTGACTGAGAAC
CTGGAACTTAAATAGGACGCGATTTCCATGGCGAAGATTAAAGGTGTAAATGCGCGAGCAGAAGATCGAAAGGCTGGAATAGTTGAACCAGGGGTGATCTTACTCGGCTACCCCTCTGCC
AATGGGAACAGCACCGCTCCCGATGCCAATCAAGCATGGCTCAAGGATGGATCTTTTATGGCTTTCAGAGAACTTCGACAACTCGTACCCGAATTTCACCACTTCTGCGACGAGACTGCT
AAAAATATGAAGAATTTGAATGTATCTGGTGATTTTATTGGTGCTAGAATCGTGGGGAGATGGAAATCAG
GTGTGTTTTCTTAAGAGTTTCTTAATTTCAGCATTCTAGCAACTACTTGG
TTAACATCTATGATTTCCTCAGGAGCACCGCTTACCTTGGCTCCAAAGCATGATAATCCAGCGTTAAGTACAGCTCAAGATTTTGATTATTCTGACGAATTAAAACAAGAACGTTGTCCC
TATGCTGCTCATATCAG
GTAATATCTATTCACGAGATCGAAGAAGATTGAAAACATGCATGCTAAGGAAAAATTTTCTTTTCTTCATTTTTCTTCGTTTGAATGTTAGGAAAAGCAATCC
ACGTAATGGCATCCAAGGCGCGGACCCCCAGAAAACCACCTTGCCTCACCTCATGATCAGAAATTCGATACCCTACG
GTTTGTCTTTGCAAACTGGTCATATCCACAATGTGGCAGGATG
CATGAGCGCTGAGCATCAGTATGGTTTTCACTTTCAGGCCCCGAGCTCACAGGGGAAGAGAAATATTTCAAGAGAACAATAGAAAACCGTGGTTTATTATTTGTTGCTTACCAAAGTGAC
ATTGTGGCCGGATTTCAATTCGTCCAAAAG
GTAATCCTATCTTGAATTAAATCTAGTTTCATCTCTTGTGGTTTGAATGGTAAAAAATTGATTTTATGCGCTATTGGCACTTTGCTTAAA
TTTAGGCATGGTGTAATAACCCTAGTTTTCCACCGCAAACGGCCCTCAACGTATCAGCTGGATTGGACTTGTTGATCGGTCAACACAGCGATGGATCACCACGAACTGCTCAAAACATTA
CACCATCG
GTCGGTAGTCTTTTCAGTAGATTTAATTGCGCAATTATTCACATTTTGGCTACATGTTTGAAACGCTACAGGTCCCAGGAGGTAATGCAGATCCTCGCAACACGGTGACCGC
ATTTCAACCTTTTGTTGTTCCTCTTGG
GTCAGTTCGGAGAGCATTCATGAAAAGAATGAGAAAATTCTACCCTTCTTTTGGATTTCTAAATATGATGTGTTTCTGACTTGCTGACAGAAC
CCTTCTGCTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGATTGTCCATCCTCCTTCACTTGCTACATACTCAGCAACGTTTCAATTGCTATCGTTGTTGAATGTTTGACGTCAGATCTCCTCCAGCGACCGAAATTCGATGAGCAATCGCTT
TTGAAAGACATAAATAGCAAGACTGCATCG
TTTGCTAGGAAGCCATACCTCAAAGGCACAGATATCATCTTCCCGTTCACATTTGGCAAGGTCGACCTGAAAAACGTCCAAGGCGATGTT
ATTATTGGTTTGCAGAAACGGCAAGAAGCGTTTTGGTTTGGCACTTTAAGATCAGATCCAAGTTCAATCGAAGGCTTTCGCAAAAATCTGAAAACCCACTTACTTCCATTAATTACAACG
ACACAAGGTGTTATTGATGCACAAAAGGTCATAGATGATCATCAACGAAAACAGAAAAAAGGGGAGGCCAAACAATGGCTTCCGATCACCCACGTTAATTTGGGATTTGCTTATAACGGG
TTAAAGAAGTTGGGCTTGAAGCCGGAGGAGATCCCTACCGGCAGGGACGGGGTATTTTCCAAAGGTCAAAAGCTTGACGCCGTGAAAAACTTGGGAGATCCGATGATTCAAGCAACAAAA
AAGTTAAATACCTGGTCTCGCGATTTTTTGGGCGAAGTTAACACGATCGATTTCGTCGTCCTGATCACTGCTCCGGACTCGAATTTATTAAATCAAAAACTCCATCAGGTTCGCAGGATG
TTCAATGGGTTTTTGTCGCACTCTTTCCTTCGTCAAGGTAATGTCAGGCCCGGTGATCAGTATGCCAATGAGCATTTCGGATTCCCG
GACGCGATTTCCATGGCGAAGATTAAAGGTGTA
AATGCGCGAGCAGAAGATCGAAAGGCTGGAATAGTTGAACCAGGGGTGATCTTACTCGGCTACCCCTCTGCCAATGGGAACAGCACCGCTCCCGATGCCAATCAAGCATGGCTCAAGGAT
GGATCTTTTATGGCTTTCAGAGAACTTCGACAACTCGTACCCGAATTTCACCACTTCTGCGACGAGACTGCTAAAAATATGAAGAATTTGAATGTATCTGGTGATTTTATTGGTGCTAGA
ATCGTGGGGAGATGGAAATCAG
GAGCACCGCTTACCTTGGCTCCAAAGCATGATAATCCAGCGTTAAGTACAGCTCAAGATTTTGATTATTCTGACGAATTAAAACAAGAACGTTGTCCC
TATGCTGCTCATATCAG
GAAAAGCAATCCACGTAATGGCATCCAAGGCGCGGACCCCCAGAAAACCACCTTGCCTCACCTCATGATCAGAAATTCGATACCCTACGGCCCCGAGCTCACA
GGGGAAGAGAAATATTTCAAGAGAACAATAGAAAACCGTGGTTTATTATTTGTTGCTTACCAAAGTGACATTGTGGCCGGATTTCAATTCGTCCAAAAG
GCATGGTGTAATAACCCTAGT
TTTCCACCGCAAACGGCCCTCAACGTATCAGCTGGATTGGACTTGTTGATCGGTCAACACAGCGATGGATCACCACGAACTGCTCAAAACATTACACCATCG
GTCCCAGGAGGTAATGCA
GATCCTCGCAACACGGTGACCGCATTTCAACCTTTTGTTGTTCCTCTTGG
AACCCTTCTGCTCTGA

Retrieve as FASTA