Entry information : PgrDyPrx03
Entry ID 6779
Creation 2009-05-11 (Christophe Dunand)
Last sequence changes 2012-04-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-05 (Christophe Dunand)
Peroxidase information: PgrDyPrx03
Name PgrDyPrx03
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Puccinia graminis f. sp. tritici    [TaxId: 56615 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgrDyPrx03
start..stop
S start..stop
PgrDyPrx05 876 0 1..519 1..519
PgrDyPrx06 815 0 14..519 1..506
PgrDyPrx04 800 0 1..519 1..518
PgrDyPrx02 737 0 33..501 70..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 795433..795530 98 N° 2 794548..795145 598 N° 3 794159..794453 295 N° 4 793971..794085 115
N° 5 793808..793899 92 N° 6 793618..793730 113 N° 7 793404..793526 123 N° 8 793263..793330 68
N° 9 793113..793170 58  
complement(join(793113..793170,793263..793330,793404..793526,793618..793730,7938 08..793899,793971..794085,794159..794453,794548..795145,795433..795530))


exon

Literature and cross-references PgrDyPrx03
DNA ref. JGI genome:   supercontig_2_16 (795530..793113)
Cluster/Prediction ref. JGI gene:   27843
Protein sequence: PgrDyPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   519 (492)
PWM (Da):   %s   56913.08 (53979.4)  
PI (pH):   %s   5.38 (5.14) Peptide Signal:   %s   cut: 28 range:28-519
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTLTFSVSNLLFIILLSILGIRTTKAELSSSQVDLANVQGDIIIGLQKRFEAFWFCTLKSDSASIEGFRRSLKTDLLPLITTTQGVIDAQKIIDNYQRNQTEGKTKRLLPITHANLGFTFNGLRKLGMNAEEIPTGKNGVFSKGQKVDAVKNLGDPVDQATKKLKTWSDDFSDEVNSIDFVVLITAPDSHFLNKKLDQIGKIFDGYLQNSFLRQGNVRPGDQFGHEHFGFDSISAPKIEGVNAQPEDKKAGVVEPGVILLGQPSSGGNSSATDPKQAWLKDGSFMAFRELQQLVPEFQNFCDESAKSVKHLNISGDFIGARIVGRWKSGAPLSLAPNEDNPELSEAQDFDYSDELKQERCPYAAHIRKANPRNGIQSGADLRKTVLPHLMIRNGIPGPELTEEETDMMKTKENRGLLFVSYQSEIADGFQFVQTWSNNPRFPAQTAANVTAGLDLLAGQTSDESPRTAQNIIPLGSEGNTDPNNTLTAFQPFIVPLGGEYFLMPSIKAINETLGL

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAACCTTAACATTTTCCGTCTCTAACTTGCTTTTCATCATTTTACTCAGCATACTAGGAATCCGCACCACCAAGGCGGAGCTATCGTCTTCCCAGTGGGTTTTGCTTCCCATCTTC
ACTCCATCAATTTCTCATCTTCCTTTAAAGTGTACATTTGGCGAGTGTCTTGATTCTACTCGCCAGGTCTATCATTTTTCTTTGTGATTTCGACCACCTTCCAACTGAATCGAATGACAT
GCGACTTGACTGAGCCATAGCCATCTCAGAAATAAGACGTTGCAAAAGCAAAACATTATATGACGCTTCATGACTCATGTTGCATTTCCAATACTTTCCTTGCTGACGTACATCTTGTTT
ATCTCTCATTTTTTCTGCTTGATAGGGTCGATCTGGCAAACGTCCAAGGCGATATTATTATTGGTTTGCAGAAACGTTTTGAAGCATTTTGGTTCTGCACTTTAAAATCAGATTCAGCAT
CAATCGAAGGCTTTCGCAGAAGCCTAAAAACCGACTTGCTTCCATTAATTACAACAACACAAGGTGTGATTGATGCACAAAAGATCATAGATAATTATCAACGAAACCAGACAGAAGGGA
AGACCAAGCGATTGCTGCCCATTACACACGCTAATCTAGGATTTACATTTAATGGATTGAGAAAGTTGGGCATGAACGCAGAAGAGATCCCGACAGGAAAAAATGGAGTATTTTCAAAAG
GTCAAAAAGTTGACGCCGTGAAAAACTTGGGAGATCCGGTGGATCAAGCAACGAAAAAGTTAAAAACCTGGTCTGACGATTTCTCAGACGAAGTTAACTCGATTGATTTCGTGGTTCTGA
TCACTGCCCCGGACTCGCATTTCCTGAATAAAAAACTCGACCAAATTGGCAAGATATTTGATGGGTACTTGCAAAACTCTTTCCTTCGTCAAGGTAACGTCAGACCTGGTGACCAGTTTG
GTCATGAGCATTTCGGATTTACT
GTTGAGTAACATCATTCATTTCATTCTGTTATTCGTGATACGGATTCATGAGTTTCTCAATCAGTGGCTGACTAAGAATGGGCAACTTAAAAAGGAC
TCGATTTCGGCGCCAAAGATTGAAGGTGTAAATGCTCAACCAGAAGATAAAAAGGCCGGAGTAGTTGAACCAGGGGTTATCTTACTTGGACAACCTTCTTCCGGTGGGAACAGTAGCGCC
ACGGATCCCAAACAAGCATGGCTCAAAGACGGATCGTTTATGGCTTTCAGAGAGCTCCAACAACTTGTACCAGAGTTTCAAAATTTCTGCGATGAGTCTGCTAAAAGTGTCAAACACTTG
AATATATCTGGTGATTTTATTGGTGCCAGAATCGTGGGCAGGTGGAAATCAG
GTGTGATTTTGGGAGATTTTCTCAAGACTTTAGCAGCCAAGCAAGTGCCCGATTAACGTTTCTTTTTT
CTCAGGAGCACCCCTCAGTTTGGCTCCCAACGAGGATAATCCGGAATTAAGTGAAGCGCAGGATTTTGACTATTCCGATGAATTGAAACAAGAACGTTGTCCCTATGCTGCTCACATCAG
GTACTGTCTTCTGACGCGATTGGCGAGAATTGCATGCTCAGAATAGTTTTCTTTCTTCGTTTCAACTTTAGGAAAGCTAACCCACGCAATGGCATTCAATCCGGCGCAGACCTCCGAAAA
ACTGTCTTGCCTCACCTCATGATCAGGAATGGGATTCCCTATG
GTTTGTTTTTGTGGAAGCATCAACTTCATATCAGAAAGGATAAAAGCTAACATTGATATTCTGAATTTAACTTGTAG

GCCCCGAGCTCACAGAGGAAGAAACAGACATGATGAAAACAAAAGAAAACCGTGGTTTGTTGTTTGTCTCTTACCAAAGTGAAATTGCGGACGGATTTCAATTTGTCCAAAAG
GTAACCC
TATTTTTAATCAGATAATATTCTTTCTTTCGATATAAGTGATAAAAGAATAACTCTATCTTTTTGGTCCTTTCCTTGAACCAAGACATGGAGTAATAATCCTCGTTTTCCCGCGCAAACG
GCCGCCAACGTAACCGCAGGATTAGACTTGTTAGCCGGTCAAACCAGCGATGAATCGCCACGAACCGCTCAAAACATCATTCCTTTG
GTAAGTAGTATTGGTTAATTTGTTTTTCAAATA
AGATATTCATTTTTTTGGCTATATGTTTGCAACACCACAGGGTTCGGAAGGGAACACTGATCCCAACAATACGTTGACCGCGTTTCAACCTTTCATTGTTCCTCTTGGGTCAGTTCAATG
AATCCTCGAGTTCACAACATATCGCTGAAATTTCTGTTTTTCACATCCGCTGATGGGATCCTCACGCGTCTAATCTGTAGTGGAGAGTACTTTTTGATGCCATCCATCAAAGCCATCAAT
GAAACACTTGGCCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAACCTTAACATTTTCCGTCTCTAACTTGCTTTTCATCATTTTACTCAGCATACTAGGAATCCGCACCACCAAGGCGGAGCTATCGTCTTCCCAGGTCGATCTGGCAAACGTCCAA
GGCGATATTATTATTGGTTTGCAGAAACGTTTTGAAGCATTTTGGTTCTGCACTTTAAAATCAGATTCAGCATCAATCGAAGGCTTTCGCAGAAGCCTAAAAACCGACTTGCTTCCATTA
ATTACAACAACACAAGGTGTGATTGATGCACAAAAGATCATAGATAATTATCAACGAAACCAGACAGAAGGGAAGACCAAGCGATTGCTGCCCATTACACACGCTAATCTAGGATTTACA
TTTAATGGATTGAGAAAGTTGGGCATGAACGCAGAAGAGATCCCGACAGGAAAAAATGGAGTATTTTCAAAAGGTCAAAAAGTTGACGCCGTGAAAAACTTGGGAGATCCGGTGGATCAA
GCAACGAAAAAGTTAAAAACCTGGTCTGACGATTTCTCAGACGAAGTTAACTCGATTGATTTCGTGGTTCTGATCACTGCCCCGGACTCGCATTTCCTGAATAAAAAACTCGACCAAATT
GGCAAGATATTTGATGGGTACTTGCAAAACTCTTTCCTTCGTCAAGGTAACGTCAGACCTGGTGACCAGTTTGGTCATGAGCATTTCGGATTTACT
GACTCGATTTCGGCGCCAAAGATT
GAAGGTGTAAATGCTCAACCAGAAGATAAAAAGGCCGGAGTAGTTGAACCAGGGGTTATCTTACTTGGACAACCTTCTTCCGGTGGGAACAGTAGCGCCACGGATCCCAAACAAGCATGG
CTCAAAGACGGATCGTTTATGGCTTTCAGAGAGCTCCAACAACTTGTACCAGAGTTTCAAAATTTCTGCGATGAGTCTGCTAAAAGTGTCAAACACTTGAATATATCTGGTGATTTTATT
GGTGCCAGAATCGTGGGCAGGTGGAAATCAG
GAGCACCCCTCAGTTTGGCTCCCAACGAGGATAATCCGGAATTAAGTGAAGCGCAGGATTTTGACTATTCCGATGAATTGAAACAAGAA
CGTTGTCCCTATGCTGCTCACATCAG
GAAAGCTAACCCACGCAATGGCATTCAATCCGGCGCAGACCTCCGAAAAACTGTCTTGCCTCACCTCATGATCAGGAATGGGATTCCCTATGGC
CCCGAGCTCACAGAGGAAGAAACAGACATGATGAAAACAAAAGAAAACCGTGGTTTGTTGTTTGTCTCTTACCAAAGTGAAATTGCGGACGGATTTCAATTTGTCCAAAAG
ACATGGAGT
AATAATCCTCGTTTTCCCGCGCAAACGGCCGCCAACGTAACCGCAGGATTAGACTTGTTAGCCGGTCAAACCAGCGATGAATCGCCACGAACCGCTCAAAACATCATTCCTTTG
GGTTCG
GAAGGGAACACTGATCCCAACAATACGTTGACCGCGTTTCAACCTTTCATTGTTCCTCTTGG
TGGAGAGTACTTTTTGATGCCATCCATCAAAGCCATCAATGAAACACTTGGCCTTTGA

Retrieve as FASTA