Entry information : PgrDyPrx04
Entry ID 6780
Creation 2009-05-11 (Christophe Dunand)
Last sequence changes 2009-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: PgrDyPrx04
Name PgrDyPrx04
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Puccinia graminis f. sp. tritici    [TaxId: 56615 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgrDyPrx04
start..stop
S start..stop
PgrDyPrx05 798 0 1..518 1..519
PgrDyPrx03 786 0 1..518 1..519
PgrDyPrx06 751 0 14..518 1..506
PgrDyPrx02 733 0 33..500 70..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 798679..798776 98 N° 2 797971..798568 598 N° 3 797581..797875 295 N° 4 797391..797505 115
N° 5 797215..797303 89 N° 6 797020..797132 113 N° 7 796807..796929 123 N° 8 796667..796734 68
N° 9 796496..796553 58  
complement(join(796496..796553,796667..796734,796807..796929,797020..797132,7972 15..797303,797391..797505,797581..797875,797971..798568,798679..798776))


exon

Literature and cross-references PgrDyPrx04
DNA ref. JGI genome:   supercontig_2_16 (798776..796496)
Protein sequence: PgrDyPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   518 (491)
PWM (Da):   %s   57646.3 (54677.7) Transmb domain:   %s   i7-25o
PI (pH):   %s   4.93 (4.87) Peptide Signal:   %s   cut: 28 range:28-518
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNSTVSISNFYMLVLFSLLSIQAIKADMSPNRVDLKNVQGDIIIGLQKRYEAFWFCSLKSDPGSIEGFRRKLKSDLLPLITTTQGVIDTQRVIDDYQQNLEEGEAKKWLPITHVNLGFTYDGLEKLGLKAEEIPNGKNGVFLKGQKLDAIDNLGDPVDQAAKKLKTWSDDFLDEVNPIDFVVLITAPNSNLLDQKLDQVRRMLDGYLSRSFLRQGNVRPGNQYGNEHFGYDSISIPKIKGVNARPEDEKAGIVEPNVILLGYPSPNGNNTDPDSNHAWLKDGSFMVFRQLQQLVPEFQTFCVETAEKFEHLNISGEFIGARIIGRWKSGAPLSLAPNEDNPELSGSQDFDYSDELKQERCPYAAHIRKTNPRIGARPNADHNLVLRRLMVRSGIPGPELTEEEKTMKRTEENRGLLFVSYQGEIADGFQHVQAWCNNPNFPSQPVANVSSGLDLLVGQNSDESPRTAQNIVPLIPGGNTDPDNTLTAFQPFVVPLGGEYFFMPSINAISEKLGL

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGAACTCGACAGTCTCTATATCTAACTTTTATATGCTCGTTCTATTCAGCTTGCTAAGTATCCAAGCTATCAAGGCCGACATGTCACCTAACCGGTGGGTTTTGATTTCTGTTTCT
ACTCCACAGGTTCTGTGAAATATGCCCCGTTTTGAGTTTTCCTGCTGACTTGAGTCTTGATTTAAATCCCGCTATTCTTCCTTGGTAGGGTCGATTTAAAAAACGTCCAAGGCGATATTA
TCATTGGTTTGCAAAAACGTTACGAGGCGTTCTGGTTTTGCAGTTTGAAATCAGACCCAGGATCAATCGAAGGTTTTCGTAGAAAATTGAAAAGCGACTTACTTCCGTTGATCACAACGA
CGCAAGGCGTGATTGACACACAAAGGGTTATAGATGATTATCAACAAAACCTGGAAGAAGGGGAAGCCAAAAAATGGCTTCCGATTACGCACGTTAATTTAGGATTTACTTATGATGGAT
TGGAGAAGTTGGGCTTGAAGGCCGAGGAGATCCCTAACGGCAAGAACGGAGTATTTTTAAAAGGTCAAAAACTTGATGCCATCGACAACTTGGGAGACCCGGTAGATCAAGCAGCGAAAA
AATTAAAAACATGGTCTGATGATTTTTTGGATGAAGTTAACCCGATCGATTTCGTCGTCTTGATCACTGCCCCAAACTCGAATTTACTAGATCAAAAACTGGACCAGGTCCGCAGGATGT
TGGATGGGTACTTGTCTAGATCTTTTCTTCGCCAGGGTAATGTCAGGCCTGGTAATCAGTATGGTAATGAGCATTTTGGATACCCG
GTTAAGTGTCTTGCTTTCTCTTGTTGTTTTCTGT
TATATACTTGGCACGACACTTCTTCAATCAACACCTGACTCAGAATCGGTAACTTGAACAGGATTCGATTTCCATCCCGAAGATCAAAGGTGTAAATGCTCGACCGGAAGATGAAAAAGC
CGGGATAGTTGAACCAAATGTGATCTTACTAGGCTACCCCTCTCCCAATGGGAACAACACTGATCCCGATTCCAATCACGCATGGCTCAAAGATGGCTCGTTTATGGTTTTCCGACAGCT
CCAACAACTCGTACCCGAGTTTCAAACCTTTTGTGTTGAGACCGCTGAAAAATTTGAACACTTGAACATATCTGGTGAATTTATTGGTGCTAGAATCATAGGCAGATGGAAATCAG
GTAT
CTTTTCATCAGACTTGCGCAATATCACTGGCCTAGAATGTGCTTGATTGATGCTTTCTTTTTAATTTCCAGGAGCACCGCTGAGCTTGGCTCCCAACGAGGATAATCCAGAATTGAGTGG
ATCACAAGATTTTGACTATTCGGATGAATTGAAACAAGAGCGGTGCCCCTATGCTGCTCACATCAG
GTATTATTTTTCCACAATTCGAATGAGAGTAGAATCTCACAGTCTTAAAATGCG
TTCTTTTCAACGTTTTTGCTGCCAAATTTTCAGAAAAACAAACCCACGCATTGGTGCTCGACCCAACGCAGATCACAACCTCGTCTTACGTCGCCTGATGGTTAGAAGTGGAATTCCCTA
CG
GTTCGATTCAAACGTTCTTCTGTATAAATCTTAGTCTTATCCACAGAGAGCAGCGGAACACTCAATCGCTGTTCCCTTCTAGGTCCGGAGCTCACAGAGGAAGAAAAAACCATGAAGA
GAACGGAAGAAAACCGTGGTTTACTATTTGTTTCGTACCAAGGTGAAATTGCCGACGGATTCCAGCACGTTCAGAAA
GTAATCCTATCTTCCACTCATCTAATTTTCATTCCCCGTCTTG
AATCGAAAAAGCATTGAAAAGATAAACTTTATTGTTCTGGAGTTTAGGCATGGTGTAATAACCCCAACTTTCCATCACAACCAGTGGCTAATGTGTCCTCCGGATTGGATCTACTGGTCG
GTCAAAACAGCGACGAATCACCCCGAACAGCCCAAAACATCGTCCCATTG
GTTAGAAAAATGGTTTAATTTCTTTTGTTGGAAAATTATTAACCTTCTGGCTATGCATTTGCAACACCGC
AGATACCAGGAGGCAATACCGACCCTGACAACACATTGACCGCTTTTCAGCCTTTTGTTGTTCCTCTTGGGTAAGCTCATGGATCATTGGTTGATAGCGAACCGCTCTCCCTGGAATTCC
TCTGACATCGCTGAATTTTTTTTTTTTGTGCACGGATGGGACCCTCATGACTTGGATCGCCAGTGGAGAATACTTTTTCATGCCATCGATCAACGCCATAAGCGAAAAACTTGGTCTTTG
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGAACTCGACAGTCTCTATATCTAACTTTTATATGCTCGTTCTATTCAGCTTGCTAAGTATCCAAGCTATCAAGGCCGACATGTCACCTAACCGGGTCGATTTAAAAAACGTCCAA
GGCGATATTATCATTGGTTTGCAAAAACGTTACGAGGCGTTCTGGTTTTGCAGTTTGAAATCAGACCCAGGATCAATCGAAGGTTTTCGTAGAAAATTGAAAAGCGACTTACTTCCGTTG
ATCACAACGACGCAAGGCGTGATTGACACACAAAGGGTTATAGATGATTATCAACAAAACCTGGAAGAAGGGGAAGCCAAAAAATGGCTTCCGATTACGCACGTTAATTTAGGATTTACT
TATGATGGATTGGAGAAGTTGGGCTTGAAGGCCGAGGAGATCCCTAACGGCAAGAACGGAGTATTTTTAAAAGGTCAAAAACTTGATGCCATCGACAACTTGGGAGACCCGGTAGATCAA
GCAGCGAAAAAATTAAAAACATGGTCTGATGATTTTTTGGATGAAGTTAACCCGATCGATTTCGTCGTCTTGATCACTGCCCCAAACTCGAATTTACTAGATCAAAAACTGGACCAGGTC
CGCAGGATGTTGGATGGGTACTTGTCTAGATCTTTTCTTCGCCAGGGTAATGTCAGGCCTGGTAATCAGTATGGTAATGAGCATTTTGGATACCCG
GATTCGATTTCCATCCCGAAGATC
AAAGGTGTAAATGCTCGACCGGAAGATGAAAAAGCCGGGATAGTTGAACCAAATGTGATCTTACTAGGCTACCCCTCTCCCAATGGGAACAACACTGATCCCGATTCCAATCACGCATGG
CTCAAAGATGGCTCGTTTATGGTTTTCCGACAGCTCCAACAACTCGTACCCGAGTTTCAAACCTTTTGTGTTGAGACCGCTGAAAAATTTGAACACTTGAACATATCTGGTGAATTTATT
GGTGCTAGAATCATAGGCAGATGGAAATCAG
GAGCACCGCTGAGCTTGGCTCCCAACGAGGATAATCCAGAATTGAGTGGATCACAAGATTTTGACTATTCGGATGAATTGAAACAAGAG
CGGTGCCCCTATGCTGCTCACATCAG
AAAAACAAACCCACGCATTGGTGCTCGACCCAACGCAGATCACAACCTCGTCTTACGTCGCCTGATGGTTAGAAGTGGAATTCCCTACGGTCCG
GAGCTCACAGAGGAAGAAAAAACCATGAAGAGAACGGAAGAAAACCGTGGTTTACTATTTGTTTCGTACCAAGGTGAAATTGCCGACGGATTCCAGCACGTTCAGAAA
GCATGGTGTAAT
AACCCCAACTTTCCATCACAACCAGTGGCTAATGTGTCCTCCGGATTGGATCTACTGGTCGGTCAAAACAGCGACGAATCACCCCGAACAGCCCAAAACATCGTCCCATTG
ATACCAGGA
GGCAATACCGACCCTGACAACACATTGACCGCTTTTCAGCCTTTTGTTGTTCCTCTTGG
TGGAGAATACTTTTTCATGCCATCGATCAACGCCATAAGCGAAAAACTTGGTCTTTGA

Retrieve as FASTA