Entry information : PgrDyPrx05
Entry ID 6781
Creation 2009-05-11 (Christophe Dunand)
Last sequence changes 2009-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: PgrDyPrx05
Name PgrDyPrx05
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Puccinia graminis f. sp. tritici    [TaxId: 56615 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgrDyPrx05
start..stop
S start..stop
PgrDyPrx03 862 0 1..519 1..519
PgrDyPrx04 798 0 1..519 1..518
PgrDyPrx06 795 0 17..519 4..506
PgrDyPrx02 733 0 33..501 70..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 784374..784471 98 N° 2 783506..784103 598 N° 3 783119..783413 295 N° 4 782940..783054 115
N° 5 782774..782865 92 N° 6 782586..782698 113 N° 7 782371..782493 123 N° 8 782226..782293 68
N° 9 782034..782106 73  
complement(join(782034..782106,782226..782293,782371..782493,782586..782698,7827 74..782865,782940..783054,783119..783413,783506..784103,784374..784471))


exon

Literature and cross-references PgrDyPrx05
DNA ref. JGI genome:   supercontig_2_16 (784471..782034)
Protein sequence: PgrDyPrx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   524 (497)
PWM (Da):   %s   57152.15 (54186.5)  
PI (pH):   %s   5.54 (5.37) Peptide Signal:   %s   cut: 28 range:28-524
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTSTFSISTVLLIVSFSLLEVQITKADTSSTRVDLTNVQGDIIIGLQKRYEAFWFCTLKSDPGSIEGFRKNLKSDLLPLITSTQGVIDAQKVIDNSQQNQTEGESKKMLPITHVNLGFTFNGLKKLGLKAEEIPTGKNGIFSKGQKADAVTNLADPLDQETKKLKTWSDDFSDEVNPIDFVVLVTAPDSNLLNKKLDQVGKILEGHLSKSFLRQGNVRPGDQWGHEHFGFDSISTPKIEGVNAQSEDKKAGIVEPGVILLGQPPSDGNSSATDPNQAWLKDGSFMVFRELQQFVPEFQSFCDESAKNLKNSNISGDFIGARIVGRWKSGAPISLAPNEDNPDLNAAQDFDYSDEVKQERCPYAAHVRKTNPRHGASVNGDPQRNTLPHLMIRNGIPGPEVTGEEVDIMKTKENRGLLFVSYQSEIANGFQFAQVWSNNPRFPTQAAANVSAGLDLLTGQNSDGSPRTAQNIIPLLPGGNTDPNNTLTALNPFVIPLGGEYFLMPSIKAINETLGLGSKDQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAACCTCTACATTTTCCATTTCTACGGTCCTTTTGATCGTTTCATTCAGCTTGCTTGAAGTCCAAATCACCAAGGCCGACACATCGTCTACCCGGTGGGTTCTGATTTCTATTTAA
ACTCCATATTTTTTTTTTGCTTTTGTGAACAGTCCAGATTTGGCGAGTCTCTTGATTTGAGTGCAAGTTCTATCAATTGCATGTGCGACGCCGTTCACTTTCCAATCAAATCAAGTGGAA
TACGGCTTCATATGGCGATTTAAAATGAGGATCTTGCAAAACATAAACACACACATGCGTTTCGCCCTGTTTGTTCTTTCTGTGCTGACTTGAATCTTGGTTTGAATCGCAATATTTGTG
TTAAATAGGGTCGATCTAACAAACGTCCAAGGCGATATAATTATTGGTTTGCAGAAACGTTACGAAGCGTTTTGGTTTTGCACTTTGAAGTCAGATCCCGGATCAATCGAAGGCTTTCGT
AAAAACCTGAAAAGTGACTTGCTTCCATTAATTACATCGACACAAGGTGTGATCGATGCACAAAAGGTGATAGATAACTCCCAACAAAACCAGACCGAAGGGGAGTCCAAAAAAATGCTA
CCCATTACACACGTCAATCTAGGCTTTACTTTCAACGGATTGAAAAAGTTAGGCTTGAAGGCAGAGGAGATTCCCACCGGCAAAAACGGGATATTTTCGAAAGGTCAAAAAGCCGACGCC
GTGACAAACTTGGCAGACCCGCTGGATCAAGAAACAAAAAAGTTAAAAACCTGGTCTGATGATTTCTCAGACGAAGTTAACCCAATTGATTTCGTGGTGTTGGTAACTGCTCCGGACTCG
AATTTATTAAATAAAAAACTCGACCAGGTTGGCAAGATACTCGAAGGGCACTTGTCAAAGTCCTTTCTTCGTCAAGGCAATGTCAGACCTGGGGACCAGTGGGGTCATGAGCATTTTGGA
TTCAAG
GTTGATTAGTATTCATTCATTCATTCTTCTCTTCCTTTTTAACATTCTTGACGCTTTGTCAATGGCTGACTAACAATTGTGATTTTGAAAAGGACTCAATTTCGACGCCGAAGA
TTGAAGGTGTGAATGCTCAATCAGAAGACAAGAAGGCCGGAATAGTTGAACCAGGGGTGATCTTACTCGGTCAACCCCCTTCCGATGGGAACAGTAGTGCGACGGATCCTAATCAAGCTT
GGCTCAAAGATGGGTCATTTATGGTTTTCAGAGAGCTCCAACAATTCGTACCCGAGTTTCAAAGTTTTTGCGACGAGTCTGCCAAAAATCTCAAAAATTCGAATATTTCTGGTGATTTTA
TTGGTGCTAGGATCGTAGGAAGATGGAAATCAG
GTATGTTTTTGTATCTTGGCAACCATCCTAAAAAATCCTTGATTAAAGCTTCTCTTTTCTTCAGGGGCACCAATTAGCTTGGCTCCC
AACGAAGATAATCCGGATTTAAATGCAGCACAGGATTTTGACTATTCGGACGAAGTGAAACAAGAACGTTGTCCTTATGCTGCTCACGTCAG
GTATCATATTTTGACGCGATTCCATGAG
ATTGATACTCCACATGTTGATATTTATTTCTTCGTTTCAATCCTAGAAAAACCAATCCACGTCATGGTGCTTCAGTTAACGGAGACCCTCAAAGAAACACCTTGCCTCACCTCATGATCA
GAAATGGCATACCCTACG
GTTTGTCCTAGTCCTAATGACGTATTCACGGTGCGGGAGGATAAGAGTTGAACGGAGTCTGGATTGCATTTGTAGGTCCTGAGGTCACTGGTGAAGAGGTCG
ACATTATGAAAACAAAAGAAAACCGCGGTTTGCTATTCGTTTCTTATCAAAGTGAAATTGCGAACGGGTTTCAATTTGCCCAGAGG
GTAATTCTACATCATGTTCAATTTTTTTTTCTTC
CTGATTGACTCTAATAATATGTTAAGTAAATTTACTTTTCTTACTTTCCTTGAGCTAGGTGTGGTCTAACAACCCCCGTTTTCCGACGCAAGCGGCCGCTAATGTATCAGCTGGGTTAGA
TTTGCTAACCGGACAAAACAGCGATGGATCACCACGAACCGCTCAAAACATTATCCCATTG
GTAAGCAGTACCGGTAGCTCTCTATTGCAAGGAAAATGTTCATTTTTTTTGGCTATGTG
TGCAAATACCCACCACAGCTCCCAGGAGGGAACACCGACCCCAACAACACGTTGACCGCGCTTAACCCTTTTGTCATTCCTCTTGGGTCAGTTCATAGATCATTCTTCAAAAAATGATAC
AATTTCTTCAGGAATTCATTTGGAATTGCTTTAATTTCCTGTTTTTGTGATTCGATGATGGGACCTTTATTGCTCCGATTTTTAGAGGGGAATACTTCTTAATGCCATCCATCAAAGCTA
TAAACGAAACACTTGGCCTTGGATCAAAAGACCAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAACCTCTACATTTTCCATTTCTACGGTCCTTTTGATCGTTTCATTCAGCTTGCTTGAAGTCCAAATCACCAAGGCCGACACATCGTCTACCCGGGTCGATCTAACAAACGTCCAA
GGCGATATAATTATTGGTTTGCAGAAACGTTACGAAGCGTTTTGGTTTTGCACTTTGAAGTCAGATCCCGGATCAATCGAAGGCTTTCGTAAAAACCTGAAAAGTGACTTGCTTCCATTA
ATTACATCGACACAAGGTGTGATCGATGCACAAAAGGTGATAGATAACTCCCAACAAAACCAGACCGAAGGGGAGTCCAAAAAAATGCTACCCATTACACACGTCAATCTAGGCTTTACT
TTCAACGGATTGAAAAAGTTAGGCTTGAAGGCAGAGGAGATTCCCACCGGCAAAAACGGGATATTTTCGAAAGGTCAAAAAGCCGACGCCGTGACAAACTTGGCAGACCCGCTGGATCAA
GAAACAAAAAAGTTAAAAACCTGGTCTGATGATTTCTCAGACGAAGTTAACCCAATTGATTTCGTGGTGTTGGTAACTGCTCCGGACTCGAATTTATTAAATAAAAAACTCGACCAGGTT
GGCAAGATACTCGAAGGGCACTTGTCAAAGTCCTTTCTTCGTCAAGGCAATGTCAGACCTGGGGACCAGTGGGGTCATGAGCATTTTGGATTCAAG
GACTCAATTTCGACGCCGAAGATT
GAAGGTGTGAATGCTCAATCAGAAGACAAGAAGGCCGGAATAGTTGAACCAGGGGTGATCTTACTCGGTCAACCCCCTTCCGATGGGAACAGTAGTGCGACGGATCCTAATCAAGCTTGG
CTCAAAGATGGGTCATTTATGGTTTTCAGAGAGCTCCAACAATTCGTACCCGAGTTTCAAAGTTTTTGCGACGAGTCTGCCAAAAATCTCAAAAATTCGAATATTTCTGGTGATTTTATT
GGTGCTAGGATCGTAGGAAGATGGAAATCAG
GGGCACCAATTAGCTTGGCTCCCAACGAAGATAATCCGGATTTAAATGCAGCACAGGATTTTGACTATTCGGACGAAGTGAAACAAGAA
CGTTGTCCTTATGCTGCTCACGTCAG
AAAAACCAATCCACGTCATGGTGCTTCAGTTAACGGAGACCCTCAAAGAAACACCTTGCCTCACCTCATGATCAGAAATGGCATACCCTACGGT
CCTGAGGTCACTGGTGAAGAGGTCGACATTATGAAAACAAAAGAAAACCGCGGTTTGCTATTCGTTTCTTATCAAAGTGAAATTGCGAACGGGTTTCAATTTGCCCAGAGG
GTGTGGTCT
AACAACCCCCGTTTTCCGACGCAAGCGGCCGCTAATGTATCAGCTGGGTTAGATTTGCTAACCGGACAAAACAGCGATGGATCACCACGAACCGCTCAAAACATTATCCCATTG
CTCCCA
GGAGGGAACACCGACCCCAACAACACGTTGACCGCGCTTAACCCTTTTGTCATTCCTCTTGG
AGGGGAATACTTCTTAATGCCATCCATCAAAGCTATAAACGAAACACTTGGCCTTGGA
TCAAAAGACCAATGA

Retrieve as FASTA