Entry information : PgrDyPrx06
Entry ID 6782
Creation 2009-05-11 (Christophe Dunand)
Last sequence changes 2009-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: PgrDyPrx06
Name PgrDyPrx06
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Puccinia graminis f. sp. tritici    [TaxId: 56615 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgrDyPrx06
start..stop
S start..stop
PgrDyPrx03 813 0 10..506 23..519
PgrDyPrx05 795 0 4..506 17..519
PgrDyPrx04 751 0 1..506 14..518
PgrDyPrx02 719 0 20..488 70..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 780902..780960 59 N° 2 780040..780637 598 N° 3 779636..779930 295 N° 4 779458..779572 115
N° 5 779283..779374 92 N° 6 779091..779203 113 N° 7 778871..778993 123 N° 8 778741..778808 68
N° 9 778567..778624 58  
complement(join(778567..778624,778741..778808,778871..778993,779091..779203,7792 83..779374,779458..779572,779636..779930,780040..780637,780902..780960))


exon

Literature and cross-references PgrDyPrx06
DNA ref. JGI genome:   supercontig_2_16 (780960..778567)
Protein sequence: PgrDyPrx06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   506
PWM (Da):   %s   55298.42  
PI (pH):   %s   5.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLFNLFKSQATQDVTSSSQIDLSNVQGDVIIGLQKRCEAFWFCSLKTEAESIEGFRKKLKSDLLPIITTAQGVIDTQKKIDENKRNQKDGDSKELLPITQVNVGFSFNGIKKLGLKTEEIPTGRDGVFSKGQKVDAVENLGDPVDQATKKLKTWSNEFLDEVNSIDFVVLITAPDLKLLNQKLDQVRHAFGGHLSNSFVRQGSVRPGEQLGHEHFGFDSISTPKIEGFNAQPEDEKAGIIQPGVILLGQPSSGGNSVGLDPNQAWLKDGSFMAFRELQQLVPEFQAFCDDSAKKNEELNASGDFIGARIVGRWKSGAPLSLAPNEDNPELRVAQNFDYSDELKQERCPYAAHIRKSNPRNGSQAGADSQKTILPHLVIRNGIPGPELTGEETDSKKTKENRGLLFVAYQSEIADGFQLVQIWCNNPRFPARPAANVSSGLDLLIGQISDGSPRTAQNIIPVVPGGNTNPNNTLTALQPFVVPLGGEYFLMPSIKAIDEKLGL

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTGTTCAACTTATTCAAAAGTCAAGCCACCCAAGATGTCACATCGTCAAGCCAGTAAGTTTTCTTTTTCTTTCTTGTAGATAAGTTTCTCCCTGTTCGAAATTCAGTTTAGGCT
AGAAGCTTGTCTAGTTGTATCAGATTTTCCATATGATTTTGTTCACTTTTTGATGTATTTGATTGGCATACAGCTGGATATTGACATGCCAAAATTTAGATGAGAATTTACTCTCGTTCC
TTGATTTATAAACGCAATGTGTGGTCTTTCCTTGCTAATCATCTGTTTCTTAATTCGAATAACGTTTTTTTCCTTACTGACAGGATCGATCTAAGCAATGTGCAGGGCGATGTCATCATT
GGATTACAGAAACGCTGCGAAGCGTTTTGGTTTTGCAGTTTGAAAACTGAAGCAGAATCGATCGAAGGTTTTCGTAAAAAATTAAAAAGCGATTTGCTTCCGATAATTACTACAGCACAA
GGTGTGATAGACACACAAAAAAAGATAGATGAAAATAAAAGAAATCAGAAAGATGGGGATTCCAAAGAGCTGTTGCCCATTACCCAGGTTAATGTAGGATTCAGTTTTAATGGAATAAAA
AAGCTAGGTTTGAAGACAGAGGAGATCCCAACCGGCAGAGATGGCGTGTTTTCGAAAGGCCAAAAAGTTGACGCTGTGGAAAACTTGGGAGACCCGGTAGACCAAGCCACGAAAAAATTG
AAAACCTGGTCTAACGAATTTTTAGATGAAGTCAATTCGATCGATTTCGTTGTGTTGATTACTGCTCCGGACTTGAAACTACTAAATCAAAAACTCGACCAAGTTCGACACGCCTTCGGT
GGGCACTTGTCCAACTCTTTCGTTCGTCAAGGTAGCGTCAGGCCCGGTGAACAGCTTGGTCATGAACATTTTGGATTCTTG
GTTGAGCATTTCTGTGTTTCTTCATTTTTAATCCCTTTT
TAATCTTCTTGATACGGCCCATGACTTGTTCAATCAATGGCTGAACATAAATCAACATTAACTCAAAAAGGACTCGATTTCCACGCCGAAGATTGAAGGTTTCAATGCTCAACCAGAAGA
CGAAAAGGCGGGAATAATTCAACCAGGGGTAATTCTACTTGGCCAACCCTCTTCCGGTGGAAATAGCGTTGGCCTGGATCCCAATCAAGCATGGCTCAAGGATGGGTCGTTTATGGCTTT
CAGAGAGCTCCAACAACTCGTACCCGAATTTCAAGCTTTTTGCGATGATTCTGCCAAAAAGAATGAAGAATTAAATGCATCCGGTGATTTCATTGGTGCCAGAATCGTTGGTAGATGGAA
ATCAG
GTGCGATTTTATCTATCTGTAACCAACCTAGCAAATGCTTGATCCATGTTTCTTCGTTCTCAGGGGCACCACTTAGCTTGGCTCCCAACGAGGATAATCCGGAGTTACGTGTAGC
ACAAAATTTCGACTATTCGGATGAATTGAAACAAGAACGTTGTCCCTATGCTGCTCACATCAG
GTACAATCTCTTTATGTGCCAAAATGGAATTCCAAAACCACGTGTTCAGATTCTTTC
TTCTGTTCTCCATTTTATATTATTAGAAAATCCAACCCGCGGAATGGTTCTCAAGCTGGAGCGGACTCGCAGAAAACAATCTTACCTCACCTCGTGATCAGAAATGGGATTCCATACGGT
TTGCTTTTGCAAATGTTTCATACCCCCATGACTACTGAAGGATCAGATATGAATATCAGTCCGGATTCCCCTTGTAGGTCCCGAGCTCACAGGGGAAGAGACCGATTCGAAGAAAACAAA
AGAAAATCGTGGTTTATTATTCGTTGCTTACCAAAGTGAAATTGCGGACGGATTCCAGTTGGTCCAGAAG
GTAAGCCTATCTTACATCAGATACTGGAATCACTGTATTTCCGTGAGAGA
TGATTAAGTGATAACGATACCTGCTTTTGATCCTTCCCTGAGCTAAGATATGGTGTAATAACCCTCGTTTTCCAGCGCGACCGGCCGCTAACGTATCATCTGGATTGGACTTGTTGATCG
GTCAAATCAGCGATGGATCGCCGCGAACTGCTCAAAACATTATCCCAGTG
GTCAGTAGTAACTCCGATCCATTTTATTGACAAATTATTCATTTTTGGGGTATATGTTACAGGTTCCCGG
AGGTAATACCAACCCCAACAACACATTGACCGCGTTACAACCTTTTGTTGTGCCTCTTGG
GTTAGTCCATAGATCGATCATCAATTGAACCATGAGATTTCATCCGAATTCCGACAGATC
GCTGAATTGGTTGTTTCTTAACTTGCTGACGGAACCCTCACTGATCTAACATCCAGTGGAGAATATTTCTTGATGCCATCTATCAAAGCCATAGATGAAAAACTTGGTCTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTGTTCAACTTATTCAAAAGTCAAGCCACCCAAGATGTCACATCGTCAAGCCAGATCGATCTAAGCAATGTGCAGGGCGATGTCATCATTGGATTACAGAAACGCTGCGAAGCG
TTTTGGTTTTGCAGTTTGAAAACTGAAGCAGAATCGATCGAAGGTTTTCGTAAAAAATTAAAAAGCGATTTGCTTCCGATAATTACTACAGCACAAGGTGTGATAGACACACAAAAAAAG
ATAGATGAAAATAAAAGAAATCAGAAAGATGGGGATTCCAAAGAGCTGTTGCCCATTACCCAGGTTAATGTAGGATTCAGTTTTAATGGAATAAAAAAGCTAGGTTTGAAGACAGAGGAG
ATCCCAACCGGCAGAGATGGCGTGTTTTCGAAAGGCCAAAAAGTTGACGCTGTGGAAAACTTGGGAGACCCGGTAGACCAAGCCACGAAAAAATTGAAAACCTGGTCTAACGAATTTTTA
GATGAAGTCAATTCGATCGATTTCGTTGTGTTGATTACTGCTCCGGACTTGAAACTACTAAATCAAAAACTCGACCAAGTTCGACACGCCTTCGGTGGGCACTTGTCCAACTCTTTCGTT
CGTCAAGGTAGCGTCAGGCCCGGTGAACAGCTTGGTCATGAACATTTTGGATTCTTG
GACTCGATTTCCACGCCGAAGATTGAAGGTTTCAATGCTCAACCAGAAGACGAAAAGGCGGGA
ATAATTCAACCAGGGGTAATTCTACTTGGCCAACCCTCTTCCGGTGGAAATAGCGTTGGCCTGGATCCCAATCAAGCATGGCTCAAGGATGGGTCGTTTATGGCTTTCAGAGAGCTCCAA
CAACTCGTACCCGAATTTCAAGCTTTTTGCGATGATTCTGCCAAAAAGAATGAAGAATTAAATGCATCCGGTGATTTCATTGGTGCCAGAATCGTTGGTAGATGGAAATCAG
GGGCACCA
CTTAGCTTGGCTCCCAACGAGGATAATCCGGAGTTACGTGTAGCACAAAATTTCGACTATTCGGATGAATTGAAACAAGAACGTTGTCCCTATGCTGCTCACATCAG
AAAATCCAACCCG
CGGAATGGTTCTCAAGCTGGAGCGGACTCGCAGAAAACAATCTTACCTCACCTCGTGATCAGAAATGGGATTCCATACG
GTCCCGAGCTCACAGGGGAAGAGACCGATTCGAAGAAAACA
AAAGAAAATCGTGGTTTATTATTCGTTGCTTACCAAAGTGAAATTGCGGACGGATTCCAGTTGGTCCAGAAG
ATATGGTGTAATAACCCTCGTTTTCCAGCGCGACCGGCCGCTAACGTA
TCATCTGGATTGGACTTGTTGATCGGTCAAATCAGCGATGGATCGCCGCGAACTGCTCAAAACATTATCCCAGTG
GTTCCCGGAGGTAATACCAACCCCAACAACACATTGACCGCGTTA
CAACCTTTTGTTGTGCCTCTTGG
TGGAGAATATTTCTTGATGCCATCTATCAAAGCCATAGATGAAAAACTTGGTCTTTGA

Retrieve as FASTA