Entry information : PEchDyPrx02
Entry ID 6787
Creation 2009-05-13 (Marcel Zamocky)
Last sequence changes 2012-01-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: PEchDyPrx02
Name PEchDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Penicillium
Organism Penicillium chrysogenum    [TaxId: 5076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PEchDyPrx02
start..stop
S start..stop
NcDyPrx 262 1e-81 6..521 7..501
AfumDyPrx03 260 5e-81 5..516 39..498
BfuDyPrx 259 1e-80 6..521 7..501
SsclDyPrx 259 1e-80 6..521 7..498
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5213786..5213826 41 N° 2 5213507..5213729 223 N° 3 5213111..5213454 344 N° 4 5212955..5213056 102
N° 5 5212783..5212893 111 N° 6 5212619..5212725 107 N° 7 5212467..5212559 93 N° 8 5212164..5212421 258
N° 9 5211825..5212114 290  
complement(join(5211825..5212114,5212164..5212421,5212467..5212559,5212619..5212 725,5212783..5212893,5212955..5213056,5213111..5213454,5213507..5213729,5213786. .5213826))


exon

Literature and cross-references PEchDyPrx02
Literature van den Berg M.A., Albang R., Albermann K., Badger J.H., Daran J.-M., Driessen A.J.M., Garcia-Estrada C., Fedorova N.D., Harris D.M., Heijne W.H.M., Joardar V., Kiel J.A.K.W., Kovalchuk A., Martin J.F., Nierman W.C., Nijland J.G., Pronk J.T., Roubos J.A. , van der Klei I.J., van Peij N.N.M.E., Veenhuis M., von Doehren H., Wagner C., Wortman J.R., Bovenberg R.A.L.Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26:1161-1168(2008)
Protein ref. UniProtKB:   B6HSU6
DNA ref. JGI genome:   scaffold_2 (5213826..5211825)
Protein sequence: PEchDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   522
PWM (Da):   %s   58522.47  
PI (pH):   %s   6.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPPNKENIQGDIWPRLSKKHELFVFFRITDPVKFKDHLAVLVPSLTTASDAETFRKDIYKKKAEGTLKSIVFFSAINVAFSAKGLALGAEPFTDDVFNNGQWEDLTYPLEGDEKAKHNGLDDQHDWFHQFTPRNGYLDGVFTITGDTEKTLVNTVRSVKKAFGVGLEKGDIPSTGGHTIDTPSVQFVFQQQGHVLDDDKEHFGWVDGISQPIVIGLDTDEKVEEAKKGLKPIQAGTILVGGEGDQSNHPAWAKEGSFMVFRTYEQRTPEFVAWCAANTKKLKNPGQKAEAMVDLRKFSSRIVGRWPGAPLELYPDADPTPLRDPDPETNKKLLFKEWTTNHTDAFTYNPEDQTRCPYAAHIRKCGPRDDFPNYERHLMMRRGIPYGPVTETNEKGAGVSQHDRGLLFVSYQSDITNGFRFVQKEWANKADKPVDFSDKLGGKAPQGIDAIIGQMPPYYRAENDVTKYDSPAPNANFPDVEKPVPKPSKHWIPIERWVIPRGGEYFFAPSISGIRETLCK

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns). Strain="ATCC 28089 / DSM 1075 / Wisconsin 54-1255".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCTCCCAACAAGGAGAACATCCAGGGAGACATCTGGTAAGTTGATACCCTGCTATCTGTTTCAATCTGGGAATTCATTCTAATGATCCCAGGCCCCGTTTGTCCAAGAAGCATG
AGCTGTTTGTCTTCTTCCGCATCACTGACCCTGTGAAGTTCAAAGACCACCTGGCTGTCCTCGTTCCAAGTCTCACGACTGCCAGTGATGCTGAGACGTTTAGGAAGGACATTTACAAGA
AGAAGGCCGAAGGTACTCTAAAAAGTATCGTCTTTTTCTCTGCCATCAATGTTGCCTTCTCCGCCAAGGGTCTAGCAAAG
GTGGGTTATAAGACTACTCTATAATTACATGAGCCGCACT
AAACAATGCTAGCTTGGAGCGGAGCCATTCACCGATGATGTCTTCAACAACGGCCAGTGGGAGGACCTCACCTACCCCCTTGAGGGAGATGAAAAGGCAAAGCATAACGGTCTCGATGAC
CAGCATGATTGGTTCCACCAATTCACCCCACGAAATGGATATCTCGACGGTGTTTTCACTATCACCGGTGATACTGAAAAGACCTTGGTTAATACCGTTAGATCGGTTAAGAAGGCTTTC
GGAGTCGGTCTTGAGAAAGGAGACATCCCATCCACTGGAGGTCATACCATCGACACGCCAAGTGTTCAATTTGTCTTTCAGCAGCAGGGACATGTTCTTGATGATGACAAAGAACA
GTAG
GATACTTCACGCTCATTATACATATTATATCAGACTAATCCACTGTTTAGCTTTGGATGGGTTGATGGTATCTCCCAGCCAATTGTCATTGGTCTGGACACCGATGAAAAGGTCGAAGAA
GCCAAGAAGGGTTTGAAGCCAATTCAGGCTGG
GTAAGCTCTAAACATCCCACACCAAGATGCCTGGAAATCCAGTCGCTGATGGCCTCGCTAGTACTATTCTTGTTGGAGGTGAGGGCGA
TCAAAGCAATCACCCGGCTTGGGCCAAAGAGGGAAGCTTCATGGTGTTCCGCACATATGAACAAAGAACACCGGAGTTCGTTGC
GTAAGTGTACCCTCTTCGAATTTGTTCTACGATACT
ACGATAATCTAACCCTTTCAGCTGGTGTGCCGCGAACACCAAGAAATTGAAAAATCCGGGGCAAAAGGCCGAAGCTATGGTAGATCTTCGAAAATTCTCCTCCCGTATTGTTGGAAGATG
GCCCAACG
GTAAGATTGCCTCTTGGATGTGCCTTGACTTGCAGCATTCACTTACTTGATATGTACAGGAGCCCCGCTTGAACTTTACCCAGACGCAGATCCCACCCCTCTGAGGGATCCT
GATCCAGAAACGAACAAGAAGTTATTGTTCAAGGAATGGA
GTGAACAGGGTAAAAATCCTCACGAGGAATACAAAAAACTGGAAGCGACGAATCACACGGATGCCTTCACTTACAACCCT
GAGGACCAAACTAGATGTCCTTACGCTGCCCATATCCGGAAGTGCGGGCCTCGAGATGACTTCCCCAATTACGAAAGGCATCTTATGATGCGACGAGGAATCCCCTACGGACCAGTGACA
GAGACCAACGAGAAGGGTGCTGGCGTGTCCCAGCATGATCGTGGTCTGTTGTTCGTTTCCTACCAGAGCGACATCACCAACGGATTCAGGTTTGTCCAGAAAG
GTTCGTACTCCCCCACA
ATGACAATACATTCATAATTAACAACCCACAGAATGGGCAAACAAGGCGGATAAGCCTGTCGATTTCTCTGACAAGCTGGGAGGCAAAGCCCCGCAGGGTATCGACGCTATCATCGGTCA
AATGCCTCCCTACTATCGCGCGGAGAATGACGTTACCAAATATGACAGCCCAGCTCCTAATGCAAACTTCCCTGATGTTGAGAAGCCTGTGCCGAAGCCGAGCAAACACTGGATTCCTAT
TGAACGCTGGGTTATCCCTCGCGGTGGTGAGTACTTCTTTGCTCCTTCAATTTCTGGAATCAGAGAGACTCTTTGCAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCTCCCAACAAGGAGAACATCCAGGGAGACATCTGGCCCCGTTTGTCCAAGAAGCATGAGCTGTTTGTCTTCTTCCGCATCACTGACCCTGTGAAGTTCAAAGACCACCTGGCT
GTCCTCGTTCCAAGTCTCACGACTGCCAGTGATGCTGAGACGTTTAGGAAGGACATTTACAAGAAGAAGGCCGAAGGTACTCTAAAAAGTATCGTCTTTTTCTCTGCCATCAATGTTGCC
TTCTCCGCCAAGGGTCTAGCAAAG
CTTGGAGCGGAGCCATTCACCGATGATGTCTTCAACAACGGCCAGTGGGAGGACCTCACCTACCCCCTTGAGGGAGATGAAAAGGCAAAGCATAAC
GGTCTCGATGACCAGCATGATTGGTTCCACCAATTCACCCCACGAAATGGATATCTCGACGGTGTTTTCACTATCACCGGTGATACTGAAAAGACCTTGGTTAATACCGTTAGATCGGTT
AAGAAGGCTTTCGGAGTCGGTCTTGAGAAAGGAGACATCCCATCCACTGGAGGTCATACCATCGACACGCCAAGTGTTCAATTTGTCTTTCAGCAGCAGGGACATGTTCTTGATGATGAC
AAAGAACA
CTTTGGATGGGTTGATGGTATCTCCCAGCCAATTGTCATTGGTCTGGACACCGATGAAAAGGTCGAAGAAGCCAAGAAGGGTTTGAAGCCAATTCAGGCTGGTACTATTCTT
GTTGGAGGTGAGGGCGATCAAAGCAATCACCCGGCTTGGGCCAAAGAGGGAAGCTTCATGGTGTTCCGCACATATGAACAAAGAACACCGGAGTTCGTTGC
CTGGTGTGCCGCGAACACC
AAGAAATTGAAAAATCCGGGGCAAAAGGCCGAAGCTATGGTAGATCTTCGAAAATTCTCCTCCCGTATTGTTGGAAGATGGCCCAACG
GAGCCCCGCTTGAACTTTACCCAGACGCAGAT
CCCACCCCTCTGAGGGATCCTGATCCAGAAACGAACAAGAAGTTATTGTTCAAGGAATGGA
CGACGAATCACACGGATGCCTTCACTTACAACCCTGAGGACCAAACTAGATGTCCTTAC
GCTGCCCATATCCGGAAGTGCGGGCCTCGAGATGACTTCCCCAATTACGAAAGGCATCTTATGATGCGACGAGGAATCCCCTACGGACCAGTGACAGAGACCAACGAGAAGGGTGCTGGC
GTGTCCCAGCATGATCGTGGTCTGTTGTTCGTTTCCTACCAGAGCGACATCACCAACGGATTCAGGTTTGTCCAGAAAG
AATGGGCAAACAAGGCGGATAAGCCTGTCGATTTCTCTGAC
AAGCTGGGAGGCAAAGCCCCGCAGGGTATCGACGCTATCATCGGTCAAATGCCTCCCTACTATCGCGCGGAGAATGACGTTACCAAATATGACAGCCCAGCTCCTAATGCAAACTTCCCT
GATGTTGAGAAGCCTGTGCCGAAGCCGAGCAAACACTGGATTCCTATTGAACGCTGGGTTATCCCTCGCGGTGGTGAGTACTTCTTTGCTCCTTCAATTTCTGGAATCAGAGAGACTCTT
TGCAAATAA

Retrieve as FASTA