Entry information : PtritCIIAC01 (Ligninase LG6)
Entry ID 6797
Creation 2009-05-15 (Christophe Dunand)
Last sequence changes 2009-05-15 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PtritCIIAC01 (Ligninase LG6)
Name (synonym) PtritCIIAC01 (Ligninase LG6)
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora tritici-repentis    [TaxId: 45151 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtritCIIAC01
start..stop
S start..stop
PterCIIAC01 662 0 1..348 1..348
AbraCIIAC02 518 0 1..348 1..348
AalteCIIAC02 497 2e-178 1..348 1..347
LmaCIIAC02 493 5e-177 12..348 12..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3107917..3108157 241 N° 2 3108210..3109015 806  
join(3107917..3108157,3108210..3109015)


exon

Literature and cross-references PtritCIIAC01 (Ligninase LG6)
Literature The Broad Institute Genome Sequencing Platform
Protein ref. GenPept:   XP_001933683 UniProtKB:   B2VXV4
DNA ref. JGI genome:   supercontig_1.2 (3107917..3109015)
mRNA ref. GenBank:   XM_001933648
Protein sequence: PtritCIIAC01 (Ligninase LG6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (328)
PWM (Da):   %s   37954.44 (35857.2)  
PI (pH):   %s   6.51 (6.31) Peptide Signal:   %s   cut: 21 range:21-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLYNSARVLPILALSLLASAGPLETREPVPGIIDDILTGVLSGVGQLIKDVLSGAKSAIDDTKSNKPLICSLLTTDKCCIWWDVSDELTKLFVNQDLTCNDNARAAVRMGFHDAGAWEQGQTHGGADGSLLMDFGEIERPENKGLESVRLVLRDVQKKFKVGYADLAQYAHNHASISCPKGPRVRTFVGRKDATQAAPKGFLPDTRSPADELIALFERKGFTPHDLAALLGAHSTARQRFVDTTPEVADKPLDTTIGVWDVEFYNDTLNNPSGGTPSQKVFVLPSDKVLSVHPKVSDEWKSFVGDQKHWNEDYAKAYVRMSLTGVTKDQLNNLVDCTKTLPASRKVFP

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST available. Strain="Pt-1C-BFP".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTATAACTCTGCACGGGTACTTCCTATCCTCGCTCTGAGCCTCCTGGCCTCGGCAGGGCCCTTAGAGACGCGAGAACCTGTGCCAGGCATCATTGATGACATCTTGACTGGTGTT
CTCTCTGGCGTTGGACAGCTTATCAAAGACGTTCTCTCTGGTGCCAAATCGGCCATCGACGACACAAAATCAAACAAGCCTTTAATATGTTCACTGCTTACCACGGATAAGTGCTGTATT
T
GTAAGTTCACGTTACGATGACTTTCTATATCCATACGCTAACAACCCTATAGGGTGGGATGTTTCTGATGAACTCACCAAGTTGTTTGTCAACCAGGATTTGACTTGCAATGACAACGC
TCGTGCAGCAGTCCGCATGGGTTTCCACGATGCGGGTGCATGGGAGCAGGGCCAAACACATGGCGGTGCTGATGGATCACTGTTGATGGATTTCGGAGAGATTGAGCGCCCCGAAAACAA
AGGTCTCGAGAGCGTGCGTCTTGTGCTTCGTGACGTACAGAAGAAGTTCAAGGTCGGCTATGCAGACCTTGCCCAGTACGCCCACAACCACGCCAGTATCTCATGCCCAAAGGGTCCTCG
CGTGCGTACATTTGTTGGACGCAAGGATGCTACCCAGGCTGCACCTAAAGGGTTTCTCCCGGATACTCGCTCCCCAGCAGATGAACTCATTGCTCTCTTCGAGCGCAAGGGCTTTACCCC
CCACGACCTTGCCGCACTCTTAGGTGCCCATTCGACAGCCCGCCAACGCTTTGTAGACACTACTCCCGAAGTCGCTGACAAGCCTCTCGACACTACCATTGGTGTTTGGGACGTCGAGTT
CTACAACGACACGCTTAACAACCCATCGGGTGGCACCCCTTCCCAGAAAGTCTTTGTACTCCCTAGCGACAAGGTACTTTCGGTACATCCCAAGGTCAGCGATGAGTGGAAGTCATTCGT
TGGTGACCAGAAGCACTGGAATGAGGACTACGCAAAGGCGTACGTCAGGATGAGTTTGACGGGTGTGACAAAGGATCAGTTGAACAACTTGGTCGACTGCACAAAGACGCTGCCTGCTAG
CCGGAAGGTTTTCCCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTATAACTCTGCACGGGTACTTCCTATCCTCGCTCTGAGCCTCCTGGCCTCGGCAGGGCCCTTAGAGACGCGAGAACCTGTGCCAGGCATCATTGATGACATCTTGACTGGTGTT
CTCTCTGGCGTTGGACAGCTTATCAAAGACGTTCTCTCTGGTGCCAAATCGGCCATCGACGACACAAAATCAAACAAGCCTTTAATATGTTCACTGCTTACCACGGATAAGTGCTGTATT
T
GGTGGGATGTTTCTGATGAACTCACCAAGTTGTTTGTCAACCAGGATTTGACTTGCAATGACAACGCTCGTGCAGCAGTCCGCATGGGTTTCCACGATGCGGGTGCATGGGAGCAGGGC
CAAACACATGGCGGTGCTGATGGATCACTGTTGATGGATTTCGGAGAGATTGAGCGCCCCGAAAACAAAGGTCTCGAGAGCGTGCGTCTTGTGCTTCGTGACGTACAGAAGAAGTTCAAG
GTCGGCTATGCAGACCTTGCCCAGTACGCCCACAACCACGCCAGTATCTCATGCCCAAAGGGTCCTCGCGTGCGTACATTTGTTGGACGCAAGGATGCTACCCAGGCTGCACCTAAAGGG
TTTCTCCCGGATACTCGCTCCCCAGCAGATGAACTCATTGCTCTCTTCGAGCGCAAGGGCTTTACCCCCCACGACCTTGCCGCACTCTTAGGTGCCCATTCGACAGCCCGCCAACGCTTT
GTAGACACTACTCCCGAAGTCGCTGACAAGCCTCTCGACACTACCATTGGTGTTTGGGACGTCGAGTTCTACAACGACACGCTTAACAACCCATCGGGTGGCACCCCTTCCCAGAAAGTC
TTTGTACTCCCTAGCGACAAGGTACTTTCGGTACATCCCAAGGTCAGCGATGAGTGGAAGTCATTCGTTGGTGACCAGAAGCACTGGAATGAGGACTACGCAAAGGCGTACGTCAGGATG
AGTTTGACGGGTGTGACAAAGGATCAGTTGAACAACTTGGTCGACTGCACAAAGACGCTGCCTGCTAGCCGGAAGGTTTTCCCATAG

Retrieve as FASTA