Entry information : PtritCIIAA02 (Ligninase H2)
Entry ID 6798
Creation 2009-05-15 (Christophe Dunand)
Last sequence changes 2009-05-15 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: PtritCIIAA02 (Ligninase H2)
Name (synonym) PtritCIIAA02 (Ligninase H2)
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Pyrenophora
Organism Pyrenophora tritici-repentis    [TaxId: 45151 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtritCIIAA02
start..stop
S start..stop
PterCIIAA02 812 0 1..399 1..399
AalteCIIAA01 763 0 1..399 1..399
COsaCIIAA05 737 0 1..398 1..398
SturCIIAA02 736 0 1..399 1..399
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2216012..2217001 990 N° 2 2217071..2217283 213  
join(2216012..2217001,2217071..2217283)


exon

Literature and cross-references PtritCIIAA02 (Ligninase H2)
Protein ref. GenPept:   XP_001933374 UniProtKB:   B2W051
DNA ref. JGI genome:   supercontig_1.2 (2216012..2217283)
mRNA ref. GenBank:   XM_001933339.1
Protein sequence: PtritCIIAA02 (Ligninase H2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   400 (380)
PWM (Da):   %s   43633.89 (41412.7)  
PI (pH):   %s   7.77 (7.83) Peptide Signal:   %s   cut: 21 range:21-400
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRFLSYLSQALLACIPLTEAHPGMGDTMNEMRYLAAREKRQAAKELIGDLKTLADSKLTAIGKDIKAIILDQKSAESSTIDGSIPAGNIGSAACKADMCCHWKWLAYEMTAKFNGTSGRCSKFARQAVRLGFHDAAVWSKSASYGGADGSILLSDEMSRTDNNGLADIADQTKKWYTKYNQYGMSMADIIQFGANVATVVCPLGPRIRTFVGRKDNSKAGPTGLLPGEKDSADKLIKLFSDKTIDAHDLVALVGAHTTSQQHFVNTARSGDPQDSTPGIWDMAFYPQITGNPPVRVIKFQSDINLSKDSRTSPSWTQFSDRNTAQGRWNVDYAKAYTRLSVLGVNNINDLKECTKVLPPARPTFVSEDQVLLDRWLNGEFDQLNDLVDNAIQLTGVISST*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). Strain="Pt-1C-BFP".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTGTCTTACTTGAGTCAAGCCCTCTTGGCATGCATCCCCCTCACTGAAGCCCACCCAGGCATGGGCGACACAATGAACGAGATGCGCTATCTAGCCGCTCGTGAGAAGCGT
CAGGCCGCCAAAGAGCTCATCGGGGACCTCAAGACCCTCGCAGACTCCAAGCTTACAGCCATTGGCAAAGACATCAAAGCCATCATTCTTGACCAGAAGTCTGCCGAGTCATCTACCATT
GATGGTTCGATTCCCGCCGGCAACATCGGAAGTGCAGCCTGCAAAGCGGACATGTGCTGTCACTGGAAATGGCTGGCATACGAAATGACTGCGAAGTTCAACGGGACCTCCGGCCGCTGC
AGCAAGTTCGCACGCCAAGCCGTACGTCTAGGATTCCACGATGCAGCCGTGTGGTCCAAGAGCGCCAGTTACGGCGGTGCAGATGGCAGTATCCTCCTCAGCGATGAGATGTCCCGAACA
GACAACAATGGGCTCGCCGATATTGCTGATCAGACAAAGAAATGGTACACCAAGTACAACCAATATGGCATGAGCATGGCCGACATCATCCAATTTGGCGCCAACGTCGCAACCGTCGTA
TGCCCCCTTGGCCCTCGCATCCGCACCTTCGTCGGCCGCAAAGACAATAGTAAAGCCGGGCCTACTGGCTTGCTGCCCGGCGAAAAGGACTCCGCCGACAAGCTGATCAAGCTCTTTTCC
GACAAGACAATCGATGCACACGACCTCGTCGCTCTGGTTGGCGCACACACGACATCCCAGCAGCATTTTGTCAATACCGCGCGCTCAGGCGACCCCCAAGACTCTACTCCAGGAATCTGG
GATATGGCATTCTATCCCCAGATAACAGGAAACCCACCAGTTCGCGTCATCAAGTTCCAGAGCGACATCAATTTGAGCAAGGACTCGAGGACTAGTCCTTCGTGGACGCAGTTTAGTGAT
CGCAATACGGCGCAGGGTCGTTGGAACGTG
GTATGTCTCGATCAACGTCCCTCATTTGTCTGCGATGCGATGGAATTCACAGCTGACTGAACATCACAGGACTACGCCAAGGCATACACC
CGTCTCTCAGTTCTCGGTGTCAACAACATCAATGATCTGAAAGAATGCACGAAGGTCCTACCTCCGGCGCGGCCGACCTTTGTCAGTGAAGACCAGGTGCTGCTGGACAGGTGGCTGAAT
GGCGAGTTCGATCAGTTGAACGACTTGGTGGACAACGCTATTCAGTTGACGGGTGTCATATCGTCGACTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTCTGTCTTACTTGAGTCAAGCCCTCTTGGCATGCATCCCCCTCACTGAAGCCCACCCAGGCATGGGCGACACAATGAACGAGATGCGCTATCTAGCCGCTCGTGAGAAGCGT
CAGGCCGCCAAAGAGCTCATCGGGGACCTCAAGACCCTCGCAGACTCCAAGCTTACAGCCATTGGCAAAGACATCAAAGCCATCATTCTTGACCAGAAGTCTGCCGAGTCATCTACCATT
GATGGTTCGATTCCCGCCGGCAACATCGGAAGTGCAGCCTGCAAAGCGGACATGTGCTGTCACTGGAAATGGCTGGCATACGAAATGACTGCGAAGTTCAACGGGACCTCCGGCCGCTGC
AGCAAGTTCGCACGCCAAGCCGTACGTCTAGGATTCCACGATGCAGCCGTGTGGTCCAAGAGCGCCAGTTACGGCGGTGCAGATGGCAGTATCCTCCTCAGCGATGAGATGTCCCGAACA
GACAACAATGGGCTCGCCGATATTGCTGATCAGACAAAGAAATGGTACACCAAGTACAACCAATATGGCATGAGCATGGCCGACATCATCCAATTTGGCGCCAACGTCGCAACCGTCGTA
TGCCCCCTTGGCCCTCGCATCCGCACCTTCGTCGGCCGCAAAGACAATAGTAAAGCCGGGCCTACTGGCTTGCTGCCCGGCGAAAAGGACTCCGCCGACAAGCTGATCAAGCTCTTTTCC
GACAAGACAATCGATGCACACGACCTCGTCGCTCTGGTTGGCGCACACACGACATCCCAGCAGCATTTTGTCAATACCGCGCGCTCAGGCGACCCCCAAGACTCTACTCCAGGAATCTGG
GATATGGCATTCTATCCCCAGATAACAGGAAACCCACCAGTTCGCGTCATCAAGTTCCAGAGCGACATCAATTTGAGCAAGGACTCGAGGACTAGTCCTTCGTGGACGCAGTTTAGTGAT
CGCAATACGGCGCAGGGTCGTTGGAACGTG
GACTACGCCAAGGCATACACCCGTCTCTCAGTTCTCGGTGTCAACAACATCAATGATCTGAAAGAATGCACGAAGGTCCTACCTCCGGCG
CGGCCGACCTTTGTCAGTGAAGACCAGGTGCTGCTGGACAGGTGGCTGAATGGCGAGTTCGATCAGTTGAACGACTTGGTGGACAACGCTATTCAGTTGACGGGTGTCATATCGTCGACT
TAG

Retrieve as FASTA