Entry information : CheCIIAB03_C4
Entry ID 6818
Creation 2009-05-20 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Christophe Dunand)
Peroxidase information: CheCIIAB03_C4
Name CheCIIAB03_C4
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CheCIIAB03_C4
start..stop
S start..stop
CheCIIAB03_C5 602 0 1..294 1..294
COsaCIIAB03 495 1e-179 1..294 1..294
ClunCIIAB01 349 1e-121 1..294 1..295
ClunCIIAB02 315 2e-108 3..292 4..293
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34685..35359 675 N° 2 35427..35636 210  
join(34685..35359,35427..35636)


exon

Literature and cross-references CheCIIAB03_C4
DNA ref. JGI genome:   scaffold_52 (34685..35636)
mRNA ref. JGI transcript:   115229
Protein sequence: CheCIIAB03_C4
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   294 (276)
PWM (Da):   %s   31412.96 (29572.9)  
PI (pH):   %s   8.8 (8.64) Peptide Signal:   %s   cut: 19 range:19-294
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRPSAITLFALAVTPISAVDLSPRAGACPAVWQSVAKDLENLFQGCNKAARSAVRAVLHDCLPDGCNGSLILSQQECSRIENQGLKDYCHTINQKRLQYRVGAADIVQFAGAMALSACPLGPQVTALVGRKDSAAAAPPNGLPRSSDSVQSILARFAAKGFSPQDVVALLGTHSIAIQFQDDPARAGTPLDSTPAICDIRYFAETKAGTAPYSLRSDRLMSSAPETYRPWAVYAKSTAMWADAFISAWSRFAVIGNDPQSLQDCSHLIPKSTVPRARQVAHAQMMEKLTKKFIA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCTTCAGCCATCACCCTCTTTGCCCTTGCGGTGACGCCCATCTCCGCCGTGGACCTCTCGCCTCGCGCGGGCGCCTGCCCTGCTGTTTGGCAAAGCGTAGCTAAAGACCTCGAG
AATCTCTTCCAGGGTTGCAATAAAGCAGCTCGCTCAGCCGTTCGCGCTGTGCTCCACGACTGTTTGCCTGACGGCTGCAACGGCAGCTTGATCCTTTCCCAGCAAGAATGCTCACGGATC
GAGAACCAAGGACTGAAAGACTACTGCCATACAATCAACCAGAAGCGCCTTCAGTACCGTGTTGGTGCTGCTGACATAGTCCAATTTGCCGGTGCAATGGCACTCTCAGCATGCCCGCTC
GGCCCCCAGGTTACGGCGCTTGTGGGCAGAAAGGACAGCGCGGCAGCTGCACCACCAAATGGCCTACCGAGGAGCTCTGATTCTGTCCAAAGCATCTTGGCAAGGTTCGCAGCTAAGGGC
TTCAGCCCTCAAGACGTGGTTGCGCTACTTGGAACCCACAGCATTGCGATCCAGTTCCAAGATGATCCCGCGAGAGCTGGCACACCACTCGACTCGACGCCAGCTATATGTGACATTAGG
TATTTCGCAGAGACGAAGGCCGGTACTGCGCCTTATAGTCTTAGGAGTGACCGTCTCATGTCCAGCGCACCCGAG
GTAAGTATTCTGCATGTGATCAATACGTTTGAAAAATGACAAGCA
GCTAACCGGTATTAAATCATAGACTTATAGACCATGGGCCGTCTACGCAAAGTCGACAGCGATGTGGGCCGATGCTTTTATAAGTGCATGGAGCCGGTTCGCGGTCATTGGCAACGACCC
ACAGAGTCTCCAGGACTGCTCTCATCTTATCCCCAAGTCCACGGTTCCCCGTGCCAGACAGGTGGCTCACGCACAAATGATGGAAAAGTTGACCAAGAAGTTCATAGCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCCTTCAGCCATCACCCTCTTTGCCCTTGCGGTGACGCCCATCTCCGCCGTGGACCTCTCGCCTCGCGCGGGCGCCTGCCCTGCTGTTTGGCAAAGCGTAGCTAAAGACCTCGAG
AATCTCTTCCAGGGTTGCAATAAAGCAGCTCGCTCAGCCGTTCGCGCTGTGCTCCACGACTGTTTGCCTGACGGCTGCAACGGCAGCTTGATCCTTTCCCAGCAAGAATGCTCACGGATC
GAGAACCAAGGACTGAAAGACTACTGCCATACAATCAACCAGAAGCGCCTTCAGTACCGTGTTGGTGCTGCTGACATAGTCCAATTTGCCGGTGCAATGGCACTCTCAGCATGCCCGCTC
GGCCCCCAGGTTACGGCGCTTGTGGGCAGAAAGGACAGCGCGGCAGCTGCACCACCAAATGGCCTACCGAGGAGCTCTGATTCTGTCCAAAGCATCTTGGCAAGGTTCGCAGCTAAGGGC
TTCAGCCCTCAAGACGTGGTTGCGCTACTTGGAACCCACAGCATTGCGATCCAGTTCCAAGATGATCCCGCGAGAGCTGGCACACCACTCGACTCGACGCCAGCTATATGTGACATTAGG
TATTTCGCAGAGACGAAGGCCGGTACTGCGCCTTATAGTCTTAGGAGTGACCGTCTCATGTCCAGCGCACCCGAG
ACTTATAGACCATGGGCCGTCTACGCAAAGTCGACAGCGATGTGG
GCCGATGCTTTTATAAGTGCATGGAGCCGGTTCGCGGTCATTGGCAACGACCCACAGAGTCTCCAGGACTGCTCTCATCTTATCCCCAAGTCCACGGTTCCCCGTGCCAGACAGGTGGCT
CACGCACAAATGATGGAAAAGTTGACCAAGAAGTTCATAGCATAG

Retrieve as FASTA