Entry information : CheCIIAC04_C4
Entry ID 6819
Creation 2009-05-20 (Christophe Dunand)
Last sequence changes 2009-05-20 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-24 (Christophe Dunand)
Peroxidase information: CheCIIAC04_C4
Name CheCIIAC04_C4
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CheCIIAC04_C4
start..stop
S start..stop
CheCIIAC04_C5 721 0 1..347 1..347
COsaCIIAC04 688 0 1..347 1..347
ClunCIIAC01 561 0 1..347 1..346
SturCIIAC01 516 0 19..347 13..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43980..44217 238 N° 2 44269..45074 806  
join(43980..44217,44269..45074)


exon

Literature and cross-references CheCIIAC04_C4
DNA ref. JGI genome:   scaffold_25 (43980..45074)
Protein sequence: CheCIIAC04_C4
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (327)
PWM (Da):   %s   37856.13 (35788.0)  
PI (pH):   %s   8.14 (7.86) Peptide Signal:   %s   cut: 21 range:21-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFKAALTFSLLGLSLFASAGPLQQREALFDILEAELGGSFNEIGQLVQDIIGGNKPATDNNQTPKPSKCDQSKDKCCVWYDVSAELTKLFVGKDKECNDNARAAVRMGFHDAGSWDQSSSHGGADGSLIMDFGEHDRRENNGLQNVRTLLRGVRDKYKVGAADLVQYAHNHATVSCPKGPRVRTFIGRLDATKANPKGLLPDTHDNPDNLIALFKRKGISERELAALVGAHATARQRFVDTSAAAVNKPLDSTPGVWDVEFYNDTLNNPVGATAEQKVFVLPSDKALSQHPKTSGDWRRFVGNQGGWNADYARAYIKVSLFGVKQEQLAKMVDCTQTLPRSRDIFP

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAAGGCAGCTCTGACGTTTTCCCTTCTTGGGCTTTCCCTTTTTGCATCAGCAGGGCCCTTGCAACAACGGGAAGCTCTATTTGATATACTTGAAGCCGAGCTTGGTGGTAGC
TTCAACGAAATTGGGCAGCTTGTCCAAGACATCATTGGCGGCAACAAGCCTGCCACCGACAACAATCAGACACCGAAACCTTCCAAATGTGATCAGAGCAAAGATAAATGCTGCGTGT
GT
AAGTTGACCAACGTATGTCTTTGGTGCATTACAAACTGACAGACACCAGGGTACGACGTTTCCGCAGAGCTTACCAAGCTATTTGTTGGGAAAGACAAGGAGTGTAACGACAATGCTCGA
GCAGCCGTCCGCATGGGTTTCCATGATGCAGGGTCCTGGGACCAGAGTTCCAGCCACGGCGGTGCGGACGGATCGCTAATTATGGATTTTGGCGAGCATGACCGTCGCGAAAACAACGGT
CTTCAAAATGTACGTACACTGCTACGCGGGGTGCGAGACAAGTACAAGGTGGGAGCTGCCGATCTTGTGCAATACGCCCACAACCACGCAACCGTCTCGTGTCCGAAAGGACCGCGTGTG
CGTACCTTTATCGGACGGTTGGATGCCACCAAGGCCAATCCGAAGGGCCTTTTGCCAGACACTCATGACAATCCTGACAACCTGATTGCTTTGTTCAAGAGAAAGGGCATTTCTGAACGC
GAGCTGGCAGCTCTGGTGGGTGCTCACGCGACAGCGCGTCAGCGCTTCGTCGACACGTCGGCAGCAGCGGTCAATAAGCCCCTCGACTCTACTCCCGGTGTGTGGGATGTGGAGTTCTAC
AATGATACGCTCAACAACCCTGTTGGTGCTACGGCCGAGCAAAAGGTCTTTGTCCTTCCCAGCGACAAAGCACTATCCCAACACCCCAAAACTAGTGGCGACTGGCGCAGGTTTGTTGGA
AACCAGGGCGGGTGGAATGCAGACTATGCCCGAGCTTACATCAAGGTGAGCCTTTTCGGGGTCAAGCAGGAGCAGTTGGCCAAGATGGTGGACTGTACCCAGACGCTGCCTCGTAGCCGA
GACATCTTCCCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTTCAAGGCAGCTCTGACGTTTTCCCTTCTTGGGCTTTCCCTTTTTGCATCAGCAGGGCCCTTGCAACAACGGGAAGCTCTATTTGATATACTTGAAGCCGAGCTTGGTGGTAGC
TTCAACGAAATTGGGCAGCTTGTCCAAGACATCATTGGCGGCAACAAGCCTGCCACCGACAACAATCAGACACCGAAACCTTCCAAATGTGATCAGAGCAAAGATAAATGCTGCGTGT
GG
TACGACGTTTCCGCAGAGCTTACCAAGCTATTTGTTGGGAAAGACAAGGAGTGTAACGACAATGCTCGAGCAGCCGTCCGCATGGGTTTCCATGATGCAGGGTCCTGGGACCAGAGTTCC
AGCCACGGCGGTGCGGACGGATCGCTAATTATGGATTTTGGCGAGCATGACCGTCGCGAAAACAACGGTCTTCAAAATGTACGTACACTGCTACGCGGGGTGCGAGACAAGTACAAGGTG
GGAGCTGCCGATCTTGTGCAATACGCCCACAACCACGCAACCGTCTCGTGTCCGAAAGGACCGCGTGTGCGTACCTTTATCGGACGGTTGGATGCCACCAAGGCCAATCCGAAGGGCCTT
TTGCCAGACACTCATGACAATCCTGACAACCTGATTGCTTTGTTCAAGAGAAAGGGCATTTCTGAACGCGAGCTGGCAGCTCTGGTGGGTGCTCACGCGACAGCGCGTCAGCGCTTCGTC
GACACGTCGGCAGCAGCGGTCAATAAGCCCCTCGACTCTACTCCCGGTGTGTGGGATGTGGAGTTCTACAATGATACGCTCAACAACCCTGTTGGTGCTACGGCCGAGCAAAAGGTCTTT
GTCCTTCCCAGCGACAAAGCACTATCCCAACACCCCAAAACTAGTGGCGACTGGCGCAGGTTTGTTGGAAACCAGGGCGGGTGGAATGCAGACTATGCCCGAGCTTACATCAAGGTGAGC
CTTTTCGGGGTCAAGCAGGAGCAGTTGGCCAAGATGGTGGACTGTACCCAGACGCTGCCTCGTAGCCGAGACATCTTCCCTTAG

Retrieve as FASTA