Entry information : CheCIIAA05_C4
Entry ID 6820
Creation 2009-05-20 (Christophe Dunand)
Last sequence changes 2017-05-19 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-05-19 (Catherine Mathe)
Peroxidase information: CheCIIAA05_C4
Name CheCIIAA05_C4
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CheCIIAA05_C4
start..stop
S start..stop
CheCIIAA05_C5 839 0 1..404 1..404
COsaCIIAA05 823 0 1..404 1..404
SturCIIAA02 771 0 1..401 1..401
AalteCIIAA01 770 0 1..404 1..404
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37297..38286 990 N° 2 38339..38563 225  
join(37297..38286,38339..38563)


exon

Literature and cross-references CheCIIAA05_C4
DNA ref. JGI genome:   scaffold_34 (37297..38563)
mRNA ref. JGI transcript:   77142
Protein sequence: CheCIIAA05_C4
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   404 (384)
PWM (Da):   %s   44212.13 (41904.9)  
PI (pH):   %s   6.78 (7.09) Peptide Signal:   %s   cut: 21 range:21-404
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKALSYLSYVLLAYIPLAEAHPGMGDTMAEMRYLAAREKRQTSKELIGDLKTLADSKLTAIGKDIKAIILDQKSAESAVMDTSIPVGNIGSAACKADLCCHWKWLAYEMTAMFNGTSGRCNKFARQAVRLGFHDAGVWSKSSGYGGADGSILLSDEMTRADNNGLAAIADQTKKWYTKYNQYGMSMADIIQFGANVATVVCPLGPRLRTFVGRKDNSKAGPTGLLPGEKDSADKLIKLFQDKTIDAHDLVALVGAHTTSQQHFVDTTRDGDPQDSTPGIWDMAFYPQTTNNAPPRVLKFQSDINLSKDSRTSTSWAQFSDRATAQGRWNADYAKAYTRLSLLGVNNINDLKECTGVLPAERKSFVNQDQIVLDRWLQGEFDQLNNLVDDAIQLTGVISGRDAEP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCTCTATCCTACCTCAGTTATGTCCTTCTGGCATACATCCCCCTGGCTGAAGCTCACCCCGGCATGGGCGACACCATGGCCGAAATGCGCTACCTAGCCGCTCGTGAGAAGCGA
CAGACCTCTAAAGAGCTCATTGGCGATCTCAAGACCCTCGCAGATTCTAAGCTTACAGCTATCGGCAAAGACATCAAAGCCATTATCTTGGACCAAAAGTCTGCCGAGTCTGCCGTCATG
GACACGTCGATTCCAGTTGGCAACATCGGAAGTGCAGCGTGCAAAGCTGATTTGTGTTGCCACTGGAAGTGGCTCGCATATGAGATGACAGCCATGTTCAACGGTACCTCCGGTCGTTGC
AATAAATTCGCCCGTCAAGCTGTGCGTCTGGGCTTCCACGATGCAGGTGTCTGGTCGAAGAGCAGCGGCTACGGTGGTGCAGACGGCAGCATTCTTCTTAGTGATGAAATGACGAGAGCA
GACAACAATGGTCTTGCAGCCATCGCCGACCAGACGAAGAAGTGGTACACTAAATACAACCAGTATGGAATGAGCATGGCAGACATCATCCAGTTCGGCGCCAATGTCGCGACTGTCGTT
TGCCCGCTCGGCCCCCGTCTCCGCACCTTCGTTGGCCGCAAAGACAACAGCAAAGCGGGCCCCACTGGACTTTTGCCTGGGGAGAAGGACTCGGCAGATAAGCTCATAAAATTGTTTCAA
GACAAGACCATCGACGCCCATGACCTTGTAGCCCTGGTAGGCGCGCACACCACGTCGCAACAGCACTTTGTCGACACTACTCGGGACGGCGACCCGCAAGACTCGACACCCGGTATATGG
GATATGGCCTTCTACCCTCAGACCACCAACAACGCACCGCCTCGTGTCCTCAAGTTCCAAAGCGATATTAACCTCAGCAAGGACTCGAGAACAAGCACATCCTGGGCGCAGTTCAGTGAC
AGGGCTACTGCACAAGGAAGGTGGAATGCG
GTAAGTGTTTCCAATCATTCTGTTCGAGGATCCAAATTGACAAAATGATTAGGACTATGCTAAAGCTTACACGCGTCTGTCATTGCTCGG
TGTCAACAACATCAATGATCTCAAGGAATGTACAGGTGTCCTGCCTGCCGAGCGCAAATCATTCGTTAACCAAGACCAAATTGTGCTGGATAGGTGGCTACAAGGAGAGTTTGATCAGCT
CAACAACTTGGTGGATGATGCTATTCAGCTGACTGGTGTCATCTCGGGCAGGGACGCGGAACCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCTCTATCCTACCTCAGTTATGTCCTTCTGGCATACATCCCCCTGGCTGAAGCTCACCCCGGCATGGGCGACACCATGGCCGAAATGCGCTACCTAGCCGCTCGTGAGAAGCGA
CAGACCTCTAAAGAGCTCATTGGCGATCTCAAGACCCTCGCAGATTCTAAGCTTACAGCTATCGGCAAAGACATCAAAGCCATTATCTTGGACCAAAAGTCTGCCGAGTCTGCCGTCATG
GACACGTCGATTCCAGTTGGCAACATCGGAAGTGCAGCGTGCAAAGCTGATTTGTGTTGCCACTGGAAGTGGCTCGCATATGAGATGACAGCCATGTTCAACGGTACCTCCGGTCGTTGC
AATAAATTCGCCCGTCAAGCTGTGCGTCTGGGCTTCCACGATGCAGGTGTCTGGTCGAAGAGCAGCGGCTACGGTGGTGCAGACGGCAGCATTCTTCTTAGTGATGAAATGACGAGAGCA
GACAACAATGGTCTTGCAGCCATCGCCGACCAGACGAAGAAGTGGTACACTAAATACAACCAGTATGGAATGAGCATGGCAGACATCATCCAGTTCGGCGCCAATGTCGCGACTGTCGTT
TGCCCGCTCGGCCCCCGTCTCCGCACCTTCGTTGGCCGCAAAGACAACAGCAAAGCGGGCCCCACTGGACTTTTGCCTGGGGAGAAGGACTCGGCAGATAAGCTCATAAAATTGTTTCAA
GACAAGACCATCGACGCCCATGACCTTGTAGCCCTGGTAGGCGCGCACACCACGTCGCAACAGCACTTTGTCGACACTACTCGGGACGGCGACCCGCAAGACTCGACACCCGGTATATGG
GATATGGCCTTCTACCCTCAGACCACCAACAACGCACCGCCTCGTGTCCTCAAGTTCCAAAGCGATATTAACCTCAGCAAGGACTCGAGAACAAGCACATCCTGGGCGCAGTTCAGTGAC
AGGGCTACTGCACAAGGAAGGTGGAATGCG
GACTATGCTAAAGCTTACACGCGTCTGTCATTGCTCGGTGTCAACAACATCAATGATCTCAAGGAATGTACAGGTGTCCTGCCTGCCGAG
CGCAAATCATTCGTTAACCAAGACCAAATTGTGCTGGATAGGTGGCTACAAGGAGAGTTTGATCAGCTCAACAACTTGGTGGATGATGCTATTCAGCTGACTGGTGTCATCTCGGGCAGG
GACGCGGAACCATAG

Retrieve as FASTA