Entry information : CparCIIAB02
Entry ID 6822
Creation 2009-05-20 (Christophe Dunand)
Last sequence changes 2011-09-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: CparCIIAB02
Name CparCIIAB02
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Cryphonectriaceae Cryphonectria
Organism Cryphonectria parasitica    [TaxId: 5116 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CparCIIAB02
start..stop
S start..stop
HC14CIIAB01 262 9e-89 9..246 22..262
HEC38CIIAB01 257 1e-86 8..246 21..262
DescCIIAB01 249 2e-83 8..246 21..266
HCO27CIIAB01 248 4e-83 8..246 21..262
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2599339..2599624 286 N° 2 2598777..2599237 461  
complement(join(2598777..2599237,2599339..2599624))


exon

Literature and cross-references CparCIIAB02
DNA ref. JGI genome:   scaffold_7 (2599624..2598777)
mRNA ref. JGI transcript:   45469
Protein sequence: CparCIIAB02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   248
PWM (Da):   %s   25738.49  
PI (pH):   %s   3.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALVATTQAQCPAIWGTVASDLKSNLFSTCNNDTRAAIRLPFHDCYAGACDGSIILSDECATRAENVQLVDICTTLGDKATEYNVSVADLIQVAGAIAVAQCPPGPTVTVQVGRTDTSTANPTAIPGPNTNATTLIAGFEAKGFTAKELVALVGSHSAARSLAGVPFDTTVDKLDSPTYYGEVLNGTQPASIASDQDLAENNATNAAWIEYRDSQSTWNTDFASAFEKMALLGVDDTGLVDCTSTIFG

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGGTTGCCACTACCCAGGCCCAATGTCCTGCTATCTGGGGCACTGTGGCTTCAGACCTCAAGTCCAATCTCTTCTCGACTTGCAACAATGACACCCGGGCCGCAATTCGCCTG
CCATTCCACGACTGCTATGCCGGAGCCTGTGATGGGTCCATCATTCTCAGCGATGAATGTGCAACACGCGCTGAGAATGTACAACTCGTGGATATTTGCACCACTCTGGGTGACAAGGCC
ACCGAGTACAATGTCAGCGTGGCGGATCTAATCCAAGTCGCGGGTG
GTAAGCTGATGTCCTCCTCCTCTCCTGGTTCTTATACAATCCTTAAAACATGTCTCAATCATGGTAATTATGGA
CAAAATTCAACTGACATCCTATTCCAGCTATTGCCGTGGCACAATGCCCTCCAGGGCCAACGGTGACGGTGCAAGTCGGCCGAACGGACACCTCGACTGCCAACCCAACCGCAATTCCCG
GTCCCAACACGAACGCCACGACCCTCATCGCCGGCTTCGAGGCCAAGGGCTTCACGGCCAAGGAGCTCGTAGCCCTCGTCGGGTCTCACTCTGCCGCCAGGAGCCTCGCTGGTGTTCCAT
TCGATACCACGGTGGACAAGCTGGACAGCCCAACCTACTACGGCGAGGTGCTGAACGGCACGCAGCCCGCCAGCATTGCCTCCGACCAGGATCTTGCAGAGAACAACGCGACCAATGCTG
CGTGGATTGAGTACAGAGACAGCCAGAGCACATGGAACACGGACTTTGCAAGTGCCTTTGAGAAGATGGCACTTCTCGGTGTGGACGATACGGGACTCGTGGATTGTACCAGCACAATTT
TTGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGGTTGCCACTACCCAGGCCCAATGTCCTGCTATCTGGGGCACTGTGGCTTCAGACCTCAAGTCCAATCTCTTCTCGACTTGCAACAATGACACCCGGGCCGCAATTCGCCTG
CCATTCCACGACTGCTATGCCGGAGCCTGTGATGGGTCCATCATTCTCAGCGATGAATGTGCAACACGCGCTGAGAATGTACAACTCGTGGATATTTGCACCACTCTGGGTGACAAGGCC
ACCGAGTACAATGTCAGCGTGGCGGATCTAATCCAAGTCGCGGGTG
CTATTGCCGTGGCACAATGCCCTCCAGGGCCAACGGTGACGGTGCAAGTCGGCCGAACGGACACCTCGACTGCC
AACCCAACCGCAATTCCCGGTCCCAACACGAACGCCACGACCCTCATCGCCGGCTTCGAGGCCAAGGGCTTCACGGCCAAGGAGCTCGTAGCCCTCGTCGGGTCTCACTCTGCCGCCAGG
AGCCTCGCTGGTGTTCCATTCGATACCACGGTGGACAAGCTGGACAGCCCAACCTACTACGGCGAGGTGCTGAACGGCACGCAGCCCGCCAGCATTGCCTCCGACCAGGATCTTGCAGAG
AACAACGCGACCAATGCTGCGTGGATTGAGTACAGAGACAGCCAGAGCACATGGAACACGGACTTTGCAAGTGCCTTTGAGAAGATGGCACTTCTCGGTGTGGACGATACGGGACTCGTG
GATTGTACCAGCACAATTTTTGGTTAA

Retrieve as FASTA