Entry information : AbraCIIAC02
Entry ID 6827
Creation 2009-05-22 (Christophe Dunand)
Last sequence changes 2009-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: AbraCIIAC02
Name AbraCIIAC02
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Alternaria
Organism Alternaria brassicicola    [TaxId: 29001 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbraCIIAC02
start..stop
S start..stop
AalteCIIAC02 636 0 1..348 1..347
PtritCIIAC01 518 0 1..348 1..348
PterCIIAC01 518 0 1..348 1..348
LmaCIIAC02 504 0 1..348 1..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2027002..2027242 241 N° 2 2027293..2028098 806  
join(2027002..2027242,2027293..2028098)


exon

Literature and cross-references AbraCIIAC02
DNA ref. JGI genome:   Contig1 (2027002..2028098)
Protein sequence: AbraCIIAC02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (328)
PWM (Da):   %s   37797.4 (35784.3)  
PI (pH):   %s   7.79 (7.50) Peptide Signal:   %s   cut: 21 range:21-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVQSKSLALPLLALCSIASSTPLEQREAGPGLIDNILTGVLTGIEQLVADVLSGKKSPIDDTKTSKPVTCSLFSIDKCCVWYDVSAELTKQFVGADKQCNDNARAAVRMGFHDAGSWDKNAPNGGADGSLLMDFGEERRPENNGLQNIRTLLRGVQAKYKVGYADLVQYAHNHATISCPKGPRVLTFVGRKDATKAAPTGLLPDVRDDADKLINLFKQKGFSAHDLAALVGAHATARQRFVDTRKDVAEKPLDTTPGVWDVEFYNDTLNNPAGGGPDQKVFVLPSDKALSTHPKINDEWKAFVGNQIHWNVDYAKAYIRMSLLGVEKRDLLRLTDCTRTLPVSIPSFP

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST. Strain="ATCC 96836". No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCAAAGTAAATCCCTGGCTTTGCCCCTCCTCGCTTTGTGTTCTATAGCATCATCCACTCCCTTGGAACAACGTGAGGCTGGACCAGGTCTCATCGATAATATTCTTACCGGCGTT
CTTACTGGCATCGAACAGCTTGTTGCTGATGTTCTGTCTGGCAAGAAATCTCCTATTGACGACACCAAGACGAGCAAGCCGGTAACATGCTCATTATTCAGTATTGACAAATGCTGCGTG
T
GTGAGTTGTGAGAACTCTCTTGAATACATGAAAATACTGATAGCTTTTAGGGTATGATGTCTCTGCCGAACTCACCAAGCAATTCGTTGGAGCCGACAAACAATGCAACGACAATGCTC
GTGCTGCGGTCCGTATGGGTTTCCACGATGCAGGGTCTTGGGACAAGAATGCTCCCAATGGTGGTGCCGATGGATCGCTACTGATGGACTTTGGCGAAGAACGACGACCAGAGAACAACG
GCCTTCAAAACATTCGCACACTACTTCGCGGCGTACAGGCCAAGTACAAGGTCGGGTACGCTGATCTCGTCCAATATGCGCATAACCATGCCACCATCTCATGCCCGAAGGGTCCTCGCG
TACTTACTTTCGTTGGCCGCAAGGATGCTACCAAGGCCGCACCCACCGGCCTCCTACCAGATGTTCGCGACGATGCCGACAAACTGATCAACCTCTTCAAGCAAAAAGGCTTCTCAGCAC
ACGACCTCGCGGCGCTTGTAGGTGCCCACGCCACAGCCAGACAACGTTTCGTCGACACCCGCAAGGATGTCGCCGAAAAGCCTCTCGATACAACCCCTGGTGTTTGGGACGTCGAGTTCT
ACAACGACACGCTCAACAACCCCGCGGGTGGTGGCCCCGACCAGAAGGTCTTCGTACTCCCCAGTGACAAGGCACTTTCGACACATCCCAAGATCAACGACGAGTGGAAAGCTTTCGTTG
GTAATCAAATCCATTGGAATGTGGACTATGCGAAGGCGTACATTAGGATGAGTTTGTTGGGCGTAGAGAAGAGAGACCTGCTCAGATTGACGGACTGCACAAGGACTCTTCCTGTCAGTA
TACCTTCATTCCCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCCAAAGTAAATCCCTGGCTTTGCCCCTCCTCGCTTTGTGTTCTATAGCATCATCCACTCCCTTGGAACAACGTGAGGCTGGACCAGGTCTCATCGATAATATTCTTACCGGCGTT
CTTACTGGCATCGAACAGCTTGTTGCTGATGTTCTGTCTGGCAAGAAATCTCCTATTGACGACACCAAGACGAGCAAGCCGGTAACATGCTCATTATTCAGTATTGACAAATGCTGCGTG
T
GGTATGATGTCTCTGCCGAACTCACCAAGCAATTCGTTGGAGCCGACAAACAATGCAACGACAATGCTCGTGCTGCGGTCCGTATGGGTTTCCACGATGCAGGGTCTTGGGACAAGAAT
GCTCCCAATGGTGGTGCCGATGGATCGCTACTGATGGACTTTGGCGAAGAACGACGACCAGAGAACAACGGCCTTCAAAACATTCGCACACTACTTCGCGGCGTACAGGCCAAGTACAAG
GTCGGGTACGCTGATCTCGTCCAATATGCGCATAACCATGCCACCATCTCATGCCCGAAGGGTCCTCGCGTACTTACTTTCGTTGGCCGCAAGGATGCTACCAAGGCCGCACCCACCGGC
CTCCTACCAGATGTTCGCGACGATGCCGACAAACTGATCAACCTCTTCAAGCAAAAAGGCTTCTCAGCACACGACCTCGCGGCGCTTGTAGGTGCCCACGCCACAGCCAGACAACGTTTC
GTCGACACCCGCAAGGATGTCGCCGAAAAGCCTCTCGATACAACCCCTGGTGTTTGGGACGTCGAGTTCTACAACGACACGCTCAACAACCCCGCGGGTGGTGGCCCCGACCAGAAGGTC
TTCGTACTCCCCAGTGACAAGGCACTTTCGACACATCCCAAGATCAACGACGAGTGGAAAGCTTTCGTTGGTAATCAAATCCATTGGAATGTGGACTATGCGAAGGCGTACATTAGGATG
AGTTTGTTGGGCGTAGAGAAGAGAGACCTGCTCAGATTGACGGACTGCACAAGGACTCTTCCTGTCAGTATACCTTCATTCCCTTAG

Retrieve as FASTA