Entry information : BdiPrx81 (Bradi2g37070)
Entry ID 6841
Creation 2009-06-16 (Christophe Dunand)
Last sequence changes 2009-06-16 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: BdiPrx81 (Bradi2g37070)
Name (synonym) BdiPrx81 (Bradi2g37070)
Class Class III peroxidase    [Orthogroup: Prx061]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx81
start..stop
S start..stop
BdiPrx80 437 2e-154 1..341 1..372
TaPrx99-1A 420 3e-148 33..341 29..335
TaPrx99-1B 412 2e-145 18..341 19..335
OsiPrx53 412 3e-145 2..341 5..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37462089..37462292 204 N° 2 37460965..37461786 822  
complement(join(37460965..37461786,37462089..37462292))


exon

Literature and cross-references BdiPrx81 (Bradi2g37070)
DNA ref. Phytozome 12:   Bd2 (37462292..37460965)
Protein sequence: BdiPrx81 (Bradi2g37070)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (320)
PWM (Da):   %s   36619.7 (34503.5)  
PI (pH):   %s   8.21 (7.98) Peptide Signal:   %s   cut: 22 range:22-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
VRLNSGAVVLFLCLGLAFVSGQPAEAAGSKKDVDVEGTVRKEVAKAIKSNPRVGAALVRLLFHDCWVHGCDGSVLLDSNGSNNSSTEKRAENNIGLAGFDVIDTIKAKLGDNISCADIVVLAARDATDILSRGKIVYGVSTGRKDGVISTAAAADAVLPPSTLNFDQLKANFAAKNFTQRELVVLSGAHAIGVAHLSSFIDRLKPSTSTPISETYQKALGDHVKAQKKVQGTPDPAEMNNIRDMDLTFQNKSGYHPTRVNMTATAVLDNSYYSANLQNMVLFRSDWELRNDSSNAAGDAMEEFMENASKWFLLFGKAMAKLSELPAEGTRFEIRKNCRKTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1). No EST. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGAGGCTTAACTCCGGCGCCGTCGTGTTGTTTCTCTGCCTGGGGCTTGCATTCGTCTCCGGGCAGCCTGCAGAGGCCGCCGGCAGCAAGAAAGATGTTGACGTTGAGGGAACGGTTAGG
AAGGAAGTGGCCAAGGCCATCAAGAGCAACCCCCGCGTCGGCGCCGCCCTGGTCCGGTTGCTCTTCCACGACTGCTGGGTTCAT
GTAAGTTAAGCCACCGTTGCACTTGCATCTGATTAC
CTTGCATGCACTAACTAGTTAGTGTACAATAATCTATCATGCACTTGTGCTTAAAATGCCTAAATGCCCTTATGCTAGAATTATCAATCATTCTACATACTAGTACCTATTTAAAATACC
TAATTGCTCTTGTTGTGATTTGAAAAGAAGACATAAATCACCTAAATTACATCTTTGAAATTAAAAAATTGTAACAAATTACAAATGTAACCACATAATGCATGGCCCATTCCACTAGCT
TCATAACTAATGAAGAGTATATGCAGGGTTGCGACGGATCAGTGCTCTTGGATAGCAACGGCAGCAACAACAGCAGTACTGAGAAGAGGGCGGAGAACAACATAGGCCTCGCTGGCTTTG
ACGTGATCGACACGATCAAGGCCAAGCTCGGCGACAACATCTCTTGTGCCGACATAGTCGTCCTGGCCGCCCGTGACGCGACCGACATCCTCAGTCGTGGCAAGATCGTGTACGGCGTCT
CCACAGGACGAAAGGATGGCGTCATCTCAACAGCCGCCGCTGCCGATGCCGTCCTCCCGCCCTCTACCCTCAACTTCGACCAGCTCAAGGCCAACTTCGCTGCCAAGAACTTCACCCAAA
GAGAGCTCGTCGTCCTCTCCGGTGCGCACGCCATTGGCGTTGCCCACCTTTCGTCCTTCATTGATCGTCTCAAACCGTCCACGTCCACCCCGATCAGTGAAACCTACCAGAAGGCGCTCG
GCGACCATGTCAAGGCCCAGAAAAAGGTGCAAGGAACGCCTGACCCAGCGGAGATGAACAACATCCGCGACATGGACCTGACCTTCCAAAATAAGTCTGGCTATCATCCCACTAGGGTGA
ACATGACTGCGACGGCCGTCCTCGACAACAGCTACTACAGCGCCAACCTCCAGAACATGGTGCTCTTCAGGTCTGATTGGGAGCTACGTAACGACAGCAGTAACGCCGCCGGGGACGCAA
TGGAAGAGTTCATGGAGAATGCTTCAAAGTGGTTCCTCCTCTTCGGCAAGGCCATGGCCAAGCTCAGCGAGCTCCCTGCCGAGGGCACCCGCTTCGAGATCAGGAAGAACTGCAGAAAGA
CCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GTGAGGCTTAACTCCGGCGCCGTCGTGTTGTTTCTCTGCCTGGGGCTTGCATTCGTCTCCGGGCAGCCTGCAGAGGCCGCCGGCAGCAAGAAAGATGTTGACGTTGAGGGAACGGTTAGG
AAGGAAGTGGCCAAGGCCATCAAGAGCAACCCCCGCGTCGGCGCCGCCCTGGTCCGGTTGCTCTTCCACGACTGCTGGGTTCAT
GGTTGCGACGGATCAGTGCTCTTGGATAGCAACGGC
AGCAACAACAGCAGTACTGAGAAGAGGGCGGAGAACAACATAGGCCTCGCTGGCTTTGACGTGATCGACACGATCAAGGCCAAGCTCGGCGACAACATCTCTTGTGCCGACATAGTCGTC
CTGGCCGCCCGTGACGCGACCGACATCCTCAGTCGTGGCAAGATCGTGTACGGCGTCTCCACAGGACGAAAGGATGGCGTCATCTCAACAGCCGCCGCTGCCGATGCCGTCCTCCCGCCC
TCTACCCTCAACTTCGACCAGCTCAAGGCCAACTTCGCTGCCAAGAACTTCACCCAAAGAGAGCTCGTCGTCCTCTCCGGTGCGCACGCCATTGGCGTTGCCCACCTTTCGTCCTTCATT
GATCGTCTCAAACCGTCCACGTCCACCCCGATCAGTGAAACCTACCAGAAGGCGCTCGGCGACCATGTCAAGGCCCAGAAAAAGGTGCAAGGAACGCCTGACCCAGCGGAGATGAACAAC
ATCCGCGACATGGACCTGACCTTCCAAAATAAGTCTGGCTATCATCCCACTAGGGTGAACATGACTGCGACGGCCGTCCTCGACAACAGCTACTACAGCGCCAACCTCCAGAACATGGTG
CTCTTCAGGTCTGATTGGGAGCTACGTAACGACAGCAGTAACGCCGCCGGGGACGCAATGGAAGAGTTCATGGAGAATGCTTCAAAGTGGTTCCTCCTCTTCGGCAAGGCCATGGCCAAG
CTCAGCGAGCTCCCTGCCGAGGGCACCCGCTTCGAGATCAGGAAGAACTGCAGAAAGACCAACTAG

Retrieve as FASTA