Entry information : BdiPrx90 (Bradi2g38720)
Entry ID 6844
Creation 2009-06-17 (Christophe Dunand)
Last sequence changes 2009-06-17 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: BdiPrx90 (Bradi2g38720)
Name (synonym) BdiPrx90 (Bradi2g38720)
Class Class III peroxidase    [Orthogroup: Prx100]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx90
start..stop
S start..stop
BdiPrx88 554 0 1..356 1..357
BdiPrx83 301 6e-101 7..329 16..351
BdiPrx85 296 9e-100 19..332 27..308
BdiPrx89 285 4e-95 3..348 7..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38989442..38989627 186 N° 2 38989855..38990739 885  
join(38989442..38989627,38989855..38990739)


exon

Literature and cross-references BdiPrx90 (Bradi2g38720)
DNA ref. Phytozome 12:   Bd2 (38989442..38990739)
Protein sequence: BdiPrx90 (Bradi2g38720)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (333)
PWM (Da):   %s   38671.45 (36391.1)  
PI (pH):   %s   5.78 (5.23) Peptide Signal:   %s   cut: 24 range:24-356
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKGSVLVLMVALAAVFLKPAVAVVDGRYDVTMQEKVRKIVEENRFDAPGLIRILFHDCWVKGCDASVLLNMTKGENEIHAPQNGGLRGMGVIQSIKDALSVDYNYVSCADAVVFAAREATAILSNYAIVYEVDGPGRNDSTTSYAADAGVLPPPFADFDFLLANFQSKAGFGLEELVVLSGVHAIGRSHRGTFNDRLDGTVTPSSQINDDYRNAIDRKTSTYYYPASWQALVGAKPSPDMAATAENNVRDMDDVRSASRYDATGVKLTPKGVLDNSYYAANLQNMVLFKSDWTLRTNFAAGAAMQLYKEKPEIWYGLFGNAMAKLSKLAPERPQAEFVQGGARKYCDKIEPAIAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1). No EST. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGGGGTCAGTGTTGGTGCTCATGGTGGCCTTGGCCGCCGTCTTCCTGAAGCCGGCGGTGGCGGTGGTCGACGGCCGGTACGACGTAACAATGCAGGAGAAGGTGAGAAAAATA
GTGGAGGAGAACCGCTTCGACGCCCCTGGGCTCATCCGGATCCTCTTCCACGACTGCTGGGTCAAG
GTAACTAAATGAAAATATTAGCTGCTTTTTTAACACATATATTGCAGTGACTTT
TTGGTAGTATATATTTATTCAATCTGTAGATACTTGCAAAAACTCCTCTAATTCAGAGGTGACATATATAATATAAATGAAAGAGTTTTCCCAGCTACAAAAGGAGATATAATTGCAAGT
TACTCCCTCCGTTCCTAAATGTAAGACGTTACGTAAAATATAAATATGTGCAGGGCTGCGACGCATCGGTGCTGTTGAACATGACCAAAGGCGAGAACGAGATCCACGCGCCACAGAACG
GCGGCCTCCGAGGCATGGGAGTGATCCAATCCATCAAGGACGCGCTCTCCGTGGACTACAACTACGTGAGCTGCGCCGATGCCGTCGTCTTCGCGGCACGAGAGGCCACCGCCATCCTCA
GCAACTACGCCATTGTGTACGAGGTGGACGGGCCGGGCCGCAACGACTCCACCACCTCCTACGCGGCCGACGCCGGCGTCCTCCCGCCGCCCTTCGCTGACTTCGACTTCCTCCTGGCCA
ACTTCCAGAGCAAGGCGGGCTTCGGCCTGGAGGAGCTCGTTGTCCTCTCCGGCGTGCACGCCATCGGCCGATCCCACCGCGGCACCTTCAACGACCGCCTTGACGGCACCGTCACCCCAT
CCTCGCAGATCAACGACGACTACCGGAACGCCATCGACAGGAAAACCTCGACTTATTATTACCCGGCATCATGGCAAGCGCTTGTGGGGGCAAAGCCGTCGCCGGACATGGCCGCCACGG
CGGAGAACAACGTCCGCGACATGGACGACGTTAGGAGCGCGTCCAGGTACGACGCCACGGGGGTGAAGCTGACGCCTAAAGGCGTCCTGGACAACAGCTACTACGCCGCTAACCTGCAGA
ACATGGTGCTCTTCAAGTCCGACTGGACGCTAAGGACCAACTTTGCCGCCGGTGCCGCGATGCAGCTGTACAAGGAGAAGCCCGAGATCTGGTACGGCCTCTTCGGCAACGCCATGGCCA
AGCTCAGCAAGCTCGCCCCCGAGCGCCCTCAGGCCGAGTTTGTCCAGGGTGGGGCTAGGAAGTACTGCGACAAGATTGAACCGGCCATCGCGTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGGGGTCAGTGTTGGTGCTCATGGTGGCCTTGGCCGCCGTCTTCCTGAAGCCGGCGGTGGCGGTGGTCGACGGCCGGTACGACGTAACAATGCAGGAGAAGGTGAGAAAAATA
GTGGAGGAGAACCGCTTCGACGCCCCTGGGCTCATCCGGATCCTCTTCCACGACTGCTGGGTCAAG
GGCTGCGACGCATCGGTGCTGTTGAACATGACCAAAGGCGAGAACGAGATCCAC
GCGCCACAGAACGGCGGCCTCCGAGGCATGGGAGTGATCCAATCCATCAAGGACGCGCTCTCCGTGGACTACAACTACGTGAGCTGCGCCGATGCCGTCGTCTTCGCGGCACGAGAGGCC
ACCGCCATCCTCAGCAACTACGCCATTGTGTACGAGGTGGACGGGCCGGGCCGCAACGACTCCACCACCTCCTACGCGGCCGACGCCGGCGTCCTCCCGCCGCCCTTCGCTGACTTCGAC
TTCCTCCTGGCCAACTTCCAGAGCAAGGCGGGCTTCGGCCTGGAGGAGCTCGTTGTCCTCTCCGGCGTGCACGCCATCGGCCGATCCCACCGCGGCACCTTCAACGACCGCCTTGACGGC
ACCGTCACCCCATCCTCGCAGATCAACGACGACTACCGGAACGCCATCGACAGGAAAACCTCGACTTATTATTACCCGGCATCATGGCAAGCGCTTGTGGGGGCAAAGCCGTCGCCGGAC
ATGGCCGCCACGGCGGAGAACAACGTCCGCGACATGGACGACGTTAGGAGCGCGTCCAGGTACGACGCCACGGGGGTGAAGCTGACGCCTAAAGGCGTCCTGGACAACAGCTACTACGCC
GCTAACCTGCAGAACATGGTGCTCTTCAAGTCCGACTGGACGCTAAGGACCAACTTTGCCGCCGGTGCCGCGATGCAGCTGTACAAGGAGAAGCCCGAGATCTGGTACGGCCTCTTCGGC
AACGCCATGGCCAAGCTCAGCAAGCTCGCCCCCGAGCGCCCTCAGGCCGAGTTTGTCCAGGGTGGGGCTAGGAAGTACTGCGACAAGATTGAACCGGCCATCGCGTATTAA

Retrieve as FASTA