Entry information : BdiPrx88 (Bradi2g38690)
Entry ID 6845
Creation 2009-06-17 (Christophe Dunand)
Last sequence changes 2009-06-17 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: BdiPrx88 (Bradi2g38690)
Name (synonym) BdiPrx88 (Bradi2g38690)
Class Class III peroxidase    [Orthogroup: Prx100]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx88
start..stop
S start..stop
BdiPrx90 554 0 1..357 1..356
BdiPrx83 296 7e-99 5..338 11..361
BdiPrx85 287 4e-96 22..333 27..308
BdiPrx89 282 7e-94 3..333 7..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38959218..38959409 192 N° 2 38959672..38960553 882  
join(38959218..38959409,38959672..38960553)


exon

Literature and cross-references BdiPrx88 (Bradi2g38690)
DNA ref. Phytozome 12:   Bd2 (38959218..38960553)
Protein sequence: BdiPrx88 (Bradi2g38690)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (331)
PWM (Da):   %s   38623.65 (36075.1)  
PI (pH):   %s   6.68 (6.06) Peptide Signal:   %s   cut: 27 range:27-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKGSVSLVLVAFAVLLAAQLKPAVAVDGRYNTTMQEKVRKIVEANRYDAPGLIRILFHDCWVKGCDASVLLNVTEDKNEIHAPQNGGLRGMGVIQAIKDALVAANYENVSCTDALIFAAREATVVLSNYTITYDVDGPGRKDSNISVAGDAGVLPPPFADFGTLLTNFQNKTGFGLDELVILSGAHSVGRAHRAAFDDRLNKAVTPSSQIDDDYRNAIDKKTSTHPTWLQAVMGAKPTPDMAATAENNIRDMDDVRGATKYNATGVKLSPKNVLDNSYYTNNGQNMVLFKSDWVLRTNKDAAAAMKLYRENPVIWYGLFGQAMAKLSELAPERLENEFVAGGARKYCDKIEPAIAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1). No EST. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGGGTTCTGTGTCTTTGGTGCTGGTGGCCTTTGCCGTCCTACTGGCAGCGCAGCTGAAGCCGGCGGTGGCGGTGGACGGCCGCTACAACACAACCATGCAGGAGAAGGTGAGG
AAAATAGTGGAGGCGAACCGCTACGACGCCCCTGGACTCATCCGGATCCTCTTCCACGACTGCTGGGTCAAG
GTAATTGAAGAACTAAATCAGCTGTTTTTTAACATATTGCACTGCTTA
CTTCTTTTTCCTTTTCAAGTGATGCACACAACCAACTTGCACTGACTTACTGAAAATAGATATGTGACTCCGATCCATAATAAGTATCCGAGATTTCGTACAAAATTGTATTAAATTTGT
ACGTACTAAATGCCCGACACCTCTTATGGATCGAAGGAAGTATTCAATTTTGTCCATTTGCACTGACTTGGGCATGTATGAATCTGCACCGCAGGGTTGCGACGCATCGGTGCTGCTGAA
CGTGACTGAAGACAAGAACGAGATCCACGCGCCACAGAACGGCGGCCTCCGGGGCATGGGGGTGATCCAAGCCATCAAGGACGCGCTCGTCGCGGCCAACTACGAGAACGTGAGCTGCAC
CGACGCTCTCATCTTCGCGGCACGCGAGGCCACCGTCGTCCTCAGCAACTACACCATCACGTACGACGTCGACGGGCCGGGCCGAAAGGATTCCAACATCTCGGTCGCGGGCGACGCCGG
CGTCCTGCCCCCGCCCTTCGCCGACTTCGGCACCCTCCTGACCAACTTCCAAAACAAGACGGGCTTCGGCCTGGACGAGCTCGTCATCCTCTCCGGCGCGCACTCCGTTGGCCGAGCCCA
CCGGGCCGCCTTCGACGACCGCCTCAACAAGGCCGTCACCCCCTCTTCGCAGATCGACGACGACTACCGGAACGCCATCGACAAGAAAACCTCGACTCACCCGACATGGTTGCAAGCAGT
CATGGGAGCAAAGCCAACGCCGGACATGGCCGCCACGGCGGAGAACAACATCCGCGACATGGACGACGTGAGGGGCGCGACCAAGTACAACGCCACGGGGGTGAAGCTGAGCCCCAAGAA
CGTCCTGGACAACAGCTACTACACCAACAACGGGCAGAACATGGTGCTCTTCAAGTCCGACTGGGTGCTCAGGACAAACAAGGACGCCGCTGCCGCCATGAAGCTCTACAGGGAGAACCC
CGTGATCTGGTACGGCCTCTTCGGCCAGGCCATGGCCAAGCTCAGCGAGCTCGCCCCCGAGCGCCTTGAGAACGAATTTGTCGCCGGTGGAGCCAGGAAGTACTGCGACAAGATTGAACC
GGCCATCGCGTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAAGGGTTCTGTGTCTTTGGTGCTGGTGGCCTTTGCCGTCCTACTGGCAGCGCAGCTGAAGCCGGCGGTGGCGGTGGACGGCCGCTACAACACAACCATGCAGGAGAAGGTGAGG
AAAATAGTGGAGGCGAACCGCTACGACGCCCCTGGACTCATCCGGATCCTCTTCCACGACTGCTGGGTCAAG
GGTTGCGACGCATCGGTGCTGCTGAACGTGACTGAAGACAAGAACGAG
ATCCACGCGCCACAGAACGGCGGCCTCCGGGGCATGGGGGTGATCCAAGCCATCAAGGACGCGCTCGTCGCGGCCAACTACGAGAACGTGAGCTGCACCGACGCTCTCATCTTCGCGGCA
CGCGAGGCCACCGTCGTCCTCAGCAACTACACCATCACGTACGACGTCGACGGGCCGGGCCGAAAGGATTCCAACATCTCGGTCGCGGGCGACGCCGGCGTCCTGCCCCCGCCCTTCGCC
GACTTCGGCACCCTCCTGACCAACTTCCAAAACAAGACGGGCTTCGGCCTGGACGAGCTCGTCATCCTCTCCGGCGCGCACTCCGTTGGCCGAGCCCACCGGGCCGCCTTCGACGACCGC
CTCAACAAGGCCGTCACCCCCTCTTCGCAGATCGACGACGACTACCGGAACGCCATCGACAAGAAAACCTCGACTCACCCGACATGGTTGCAAGCAGTCATGGGAGCAAAGCCAACGCCG
GACATGGCCGCCACGGCGGAGAACAACATCCGCGACATGGACGACGTGAGGGGCGCGACCAAGTACAACGCCACGGGGGTGAAGCTGAGCCCCAAGAACGTCCTGGACAACAGCTACTAC
ACCAACAACGGGCAGAACATGGTGCTCTTCAAGTCCGACTGGGTGCTCAGGACAAACAAGGACGCCGCTGCCGCCATGAAGCTCTACAGGGAGAACCCCGTGATCTGGTACGGCCTCTTC
GGCCAGGCCATGGCCAAGCTCAGCGAGCTCGCCCCCGAGCGCCTTGAGAACGAATTTGTCGCCGGTGGAGCCAGGAAGTACTGCGACAAGATTGAACCGGCCATCGCGTATTAA

Retrieve as FASTA