Entry information : BdiPrx85 (Bradi2g38670)
Entry ID 6846
Creation 2009-06-17 (Christophe Dunand)
Last sequence changes 2009-06-17 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: BdiPrx85 (Bradi2g38670)
Name (synonym) BdiPrx85 (Bradi2g38670)
Class Class III peroxidase    [Orthogroup: Prx100]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx85
start..stop
S start..stop
BdiPrx87 439 3e-156 1..323 1..324
BdiPrx86 414 2e-146 25..323 24..319
BdiPrx89 405 6e-143 1..319 1..324
BdiPrx90 306 1e-103 7..308 3..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38946522..38946722 201 N° 2 38946833..38947603 771  
join(38946522..38946722,38946833..38947603)


exon

Literature and cross-references BdiPrx85 (Bradi2g38670)
DNA ref. Phytozome 12:   Bd2 (38946522..38947603)
Protein sequence: BdiPrx85 (Bradi2g38670)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (292)
PWM (Da):   %s   34585.49 (31446.6) Transmb domain:   %s   i9-31o
PI (pH):   %s   7.02 (6.36) Peptide Signal:   %s   cut: 32 range:32-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERNNKGSLLVLVALAVVVLLAAQVKPAVAGDYTTYMQNKVRDIVKANRAVAPGFIRLVFHDCWVKGCDGSVLLERADKQAEMDAPQNGGIRGLDVIQTIKDALAAFDKNVTCADAVVYAAREACYVLSDKKIEYAVDGPGSHKDALTSSMADAGALPPPFANFTDLVANFNAKGFTARDVVVLSGAHAVGQAHRPTFESRLDKSVSGRGEINGWYQGEVDRVSNASPTKAVHNNVRDLYKAEAEPGVLDNGYYKANLQNTVLFNSDWTLRTDTAAASEMQQYKDSAATWYALFGEAMARLSRLPAEGATLAVPRTKCSTAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1). No EST. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCGCAACAACAAGGGGTCTCTTTTGGTGCTGGTGGCTTTGGCCGTCGTGGTTCTCCTGGCCGCTCAGGTGAAGCCGGCGGTGGCCGGCGATTACACCACTTACATGCAGAAT
AAGGTCAGGGATATCGTGAAGGCCAACCGCGCCGTCGCCCCCGGCTTCATCCGTCTCGTCTTCCACGACTGCTGGGTCAAG
GTAACTAACTAACTAAAGATAAAACTTTTGACATTGTGC
TGACATATCGAAAACATTATTTACTTTTCTCTATTTTCAAAAATTTAATGGATGCAATTTATAATCTCTAGGGTTGCGATGGATCCGTGTTGCTGGAGAGAGCCGACAAGCAGGCGGAGA
TGGATGCGCCGCAGAACGGCGGCATCCGTGGCCTGGACGTGATCCAGACCATCAAGGACGCGCTCGCCGCCTTCGACAAGAACGTGACATGCGCCGATGCTGTCGTGTACGCGGCCCGGG
AGGCGTGCTACGTCCTCAGCGACAAGAAGATCGAGTACGCCGTGGACGGGCCGGGCTCCCACAAGGACGCCCTCACCTCGTCCATGGCCGACGCCGGCGCCCTCCCGCCACCATTCGCCA
ACTTCACGGACCTCGTGGCAAACTTCAACGCCAAGGGCTTCACGGCCCGGGATGTCGTGGTCCTCTCCGGCGCGCACGCTGTCGGCCAGGCCCACCGCCCGACCTTCGAGTCCCGGCTCG
ACAAGTCCGTCTCCGGCCGCGGCGAGATCAACGGCTGGTACCAGGGCGAGGTCGATCGGGTGTCGAACGCAAGCCCCACGAAGGCGGTTCATAACAATGTCCGCGACCTCTACAAGGCCG
AGGCGGAGCCGGGGGTGCTTGACAATGGATACTACAAGGCCAATCTCCAGAACACGGTGCTCTTCAACTCTGATTGGACGCTCAGGACGGACACCGCCGCCGCAAGCGAGATGCAACAGT
ACAAGGACAGCGCCGCTACGTGGTACGCCCTCTTCGGCGAGGCCATGGCCAGGCTCAGCAGGCTCCCCGCCGAGGGCGCCACTCTCGCCGTGCCCAGGACAAAATGCAGTACCGCCAACT
AG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGAGCGCAACAACAAGGGGTCTCTTTTGGTGCTGGTGGCTTTGGCCGTCGTGGTTCTCCTGGCCGCTCAGGTGAAGCCGGCGGTGGCCGGCGATTACACCACTTACATGCAGAAT
AAGGTCAGGGATATCGTGAAGGCCAACCGCGCCGTCGCCCCCGGCTTCATCCGTCTCGTCTTCCACGACTGCTGGGTCAAG
GGTTGCGATGGATCCGTGTTGCTGGAGAGAGCCGACAAG
CAGGCGGAGATGGATGCGCCGCAGAACGGCGGCATCCGTGGCCTGGACGTGATCCAGACCATCAAGGACGCGCTCGCCGCCTTCGACAAGAACGTGACATGCGCCGATGCTGTCGTGTAC
GCGGCCCGGGAGGCGTGCTACGTCCTCAGCGACAAGAAGATCGAGTACGCCGTGGACGGGCCGGGCTCCCACAAGGACGCCCTCACCTCGTCCATGGCCGACGCCGGCGCCCTCCCGCCA
CCATTCGCCAACTTCACGGACCTCGTGGCAAACTTCAACGCCAAGGGCTTCACGGCCCGGGATGTCGTGGTCCTCTCCGGCGCGCACGCTGTCGGCCAGGCCCACCGCCCGACCTTCGAG
TCCCGGCTCGACAAGTCCGTCTCCGGCCGCGGCGAGATCAACGGCTGGTACCAGGGCGAGGTCGATCGGGTGTCGAACGCAAGCCCCACGAAGGCGGTTCATAACAATGTCCGCGACCTC
TACAAGGCCGAGGCGGAGCCGGGGGTGCTTGACAATGGATACTACAAGGCCAATCTCCAGAACACGGTGCTCTTCAACTCTGATTGGACGCTCAGGACGGACACCGCCGCCGCAAGCGAG
ATGCAACAGTACAAGGACAGCGCCGCTACGTGGTACGCCCTCTTCGGCGAGGCCATGGCCAGGCTCAGCAGGCTCCCCGCCGAGGGCGCCACTCTCGCCGTGCCCAGGACAAAATGCAGT
ACCGCCAACTAG

Retrieve as FASTA