Entry information : BdiPrx86 (Bradi2g38680)
Entry ID 6847
Creation 2009-06-17 (Christophe Dunand)
Last sequence changes 2009-06-17 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: BdiPrx86 (Bradi2g38680)
Name (synonym) BdiPrx86 (Bradi2g38680)
Class Class III peroxidase    [Orthogroup: Prx100]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx86
start..stop
S start..stop
BdiPrx87 449 2e-160 11..319 13..324
BdiPrx85 410 7e-145 26..319 27..323
BdiPrx89 374 1e-130 4..316 3..325
BdiPrx88 281 1e-93 12..316 8..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38949876..38950076 201 N° 2 38950210..38950968 759  
join(38949876..38950076,38950210..38950968)


exon

Literature and cross-references BdiPrx86 (Bradi2g38680)
DNA ref. Phytozome 12:   Bd2 (38949876..38950968)
Protein sequence: BdiPrx86 (Bradi2g38680)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (289)
PWM (Da):   %s   33406.15 (30382.3)  
PI (pH):   %s   8.44 (7.02) Peptide Signal:   %s   cut: 31 range:31-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKRKGEKGPLLVLAALAVLLAAQVKPAVSAGGYTIDIQTKVRDIVKANRAVSPGFIRLVFHDCWVKGCDASVLLNNGDGTAEMDAVQNGGIRGLDVIQAIKDKLAVNYTDVTCADAVVYAAREACYVLSGEKIKYDVDGPGSHKDAVASSKADAAALPSPFASFSDLVANFKLKGFTARDVVVLSGAHAVGLAHRPAFEARLTAPAAEIDPAYRNDVNVTSNASPSKTAHNNVRDLGKAEAEPGVLDNNYYAANLAKKVLFGSDFALTTDGAAMTNMTAYKNNAATWYPLFEDAMARLSRLPPLGTTGGPRAKCNTPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1). No EST. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGCGCAAAGGGGAAAAAGGGCCTCTTTTGGTGCTGGCGGCATTGGCCGTCCTCCTTGCCGCGCAGGTGAAGCCGGCGGTGTCTGCCGGCGGCTACACCATTGACATTCAGACC
AAGGTGAGGGATATAGTGAAGGCCAACCGCGCCGTCAGCCCCGGCTTCATCCGCCTCGTCTTCCACGACTGCTGGGTCAAG
GTAATCATCAAAGCTGCTTAATTTCTGACATGGTACTGA
CTTGCCGAAATCCTTTTTTCGATCATTTCGACATTATTGTCCAGTTTGTACCAACTTTGCCAAAACCTTTTATTTAATAATATTTTAATACCAGGGTTGTGATGCATCGGTGCTGCTGAA
CAATGGTGACGGGACGGCGGAGATGGACGCGGTCCAGAACGGCGGCATCCGCGGCCTGGACGTGATCCAGGCCATCAAGGACAAGCTGGCCGTGAACTACACGGACGTCACCTGCGCCGA
CGCCGTAGTCTACGCGGCCCGGGAGGCCTGCTACGTCCTGAGCGGCGAGAAGATCAAGTACGACGTGGACGGGCCGGGCTCCCACAAGGACGCCGTCGCCTCCTCCAAGGCCGACGCGGC
CGCCCTCCCTTCCCCATTCGCCAGCTTCTCGGACCTCGTGGCAAACTTCAAGCTCAAGGGTTTCACGGCCCGAGACGTGGTGGTCCTCTCCGGCGCGCACGCCGTGGGCCTGGCCCACCG
CCCGGCCTTCGAGGCCCGGCTCACGGCCCCCGCCGCCGAGATCGACCCGGCATATCGGAACGACGTCAATGTGACGTCCAACGCGAGCCCGAGCAAGACGGCCCACAACAATGTCCGGGA
CCTGGGCAAGGCAGAGGCGGAGCCGGGCGTCCTGGACAACAACTACTACGCCGCCAACCTTGCCAAGAAGGTGCTCTTCGGCTCCGACTTCGCGCTCACCACCGACGGCGCCGCGATGAC
TAACATGACTGCCTACAAGAATAATGCTGCCACGTGGTACCCCCTCTTTGAGGACGCCATGGCCAGGCTCAGCAGGCTCCCCCCACTGGGCACCACAGGCGGGCCCAGGGCCAAATGCAA
CACCCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGCGCAAAGGGGAAAAAGGGCCTCTTTTGGTGCTGGCGGCATTGGCCGTCCTCCTTGCCGCGCAGGTGAAGCCGGCGGTGTCTGCCGGCGGCTACACCATTGACATTCAGACC
AAGGTGAGGGATATAGTGAAGGCCAACCGCGCCGTCAGCCCCGGCTTCATCCGCCTCGTCTTCCACGACTGCTGGGTCAAG
GGTTGTGATGCATCGGTGCTGCTGAACAATGGTGACGGG
ACGGCGGAGATGGACGCGGTCCAGAACGGCGGCATCCGCGGCCTGGACGTGATCCAGGCCATCAAGGACAAGCTGGCCGTGAACTACACGGACGTCACCTGCGCCGACGCCGTAGTCTAC
GCGGCCCGGGAGGCCTGCTACGTCCTGAGCGGCGAGAAGATCAAGTACGACGTGGACGGGCCGGGCTCCCACAAGGACGCCGTCGCCTCCTCCAAGGCCGACGCGGCCGCCCTCCCTTCC
CCATTCGCCAGCTTCTCGGACCTCGTGGCAAACTTCAAGCTCAAGGGTTTCACGGCCCGAGACGTGGTGGTCCTCTCCGGCGCGCACGCCGTGGGCCTGGCCCACCGCCCGGCCTTCGAG
GCCCGGCTCACGGCCCCCGCCGCCGAGATCGACCCGGCATATCGGAACGACGTCAATGTGACGTCCAACGCGAGCCCGAGCAAGACGGCCCACAACAATGTCCGGGACCTGGGCAAGGCA
GAGGCGGAGCCGGGCGTCCTGGACAACAACTACTACGCCGCCAACCTTGCCAAGAAGGTGCTCTTCGGCTCCGACTTCGCGCTCACCACCGACGGCGCCGCGATGACTAACATGACTGCC
TACAAGAATAATGCTGCCACGTGGTACCCCCTCTTTGAGGACGCCATGGCCAGGCTCAGCAGGCTCCCCCCACTGGGCACCACAGGCGGGCCCAGGGCCAAATGCAACACCCCCAACTAG

Retrieve as FASTA