Entry information : PoDyPrx02_PC15
Entry ID 6848
Creation 2009-06-19 (Christophe Dunand)
Last sequence changes 2011-11-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PoDyPrx02_PC15
Name PoDyPrx02_PC15
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoDyPrx02_PC15
start..stop
S start..stop
PoDyPrx03_PC15 738 0 36..511 5..479
PoDyPrx01_PC15 728 0 1..511 1..516
PoDyPrx01_other 723 0 1..511 1..525
PstrDyPrx01 462 6e-160 25..511 24..505
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 659013..659105 93 N° 2 658822..658949 128 N° 3 658656..658759 104 N° 4 658229..658602 374
N° 5 657973..658169 197 N° 6 657834..657918 85 N° 7 657555..657783 229 N° 8 657448..657504 57
N° 9 657329..657395 67 N° 10 657069..657270 202  
complement(join(657069..657270,657329..657395,657448..657504,657555..657783,6578 34..657918,657973..658169,658229..658602,658656..658759,658822..658949,659013..6 59105))


exon

Literature and cross-references PoDyPrx02_PC15
DNA ref. JGI genome:   scaffold_04 (659105..657069)
mRNA ref. JGI transcript:   156489
Protein sequence: PoDyPrx02_PC15
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   511 (488)
PWM (Da):   %s   56250.19 (53711.9)  
PI (pH):   %s   4.91 (4.82) Peptide Signal:   %s   cut: 24 range:24-511
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRWSTFCVAIASLVPYALVPIYGFTPPPHLQGPELTVSADYPGQGPLPSLEVIQRLNATNGTFLPLDEVQGDILIGMKKPKQLFFFYNIIDPKKFKQVLAKLIYPHITTSQLICTTCPQPKALLNVAWTSKGLNKLNVFDNNLDPFFNMGQVPDANALGDNNPPQNWVPGLYMDKTDGVFLIASKDWAPIDSLLAQILSWLGSSIVEVHRLKGAHRTGAWEGHEHFGFLDGSQPAVAGFATSIFPGQSLILPGTILTGEIGDPLEFSRPSWMKWGSFLAFRQLQQFVPEFDNYLLHEASAIPDSSRTVQERADLLGARMIGRWKGTPTDLAPDFDIPSIGPDFNLNNNFDFNHPAPFNLAADQSFCPFSAHIRKIRPRADEGNNNFANQIMRAGIPYGDDVTDVEWENNATKYERGLAFVSYQSDIGSGYRFQQVAWANDVNFVGGKIDPTPGFDPIFGQNGAGPIFSSGIDYTDPNHDLTFMSFVLSRGGEYLYSPSMSAILNPIAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGTGGAGCACTTTCTGCGTCGCTATCGCTTCTCTCGTTCCATACGCGTTGGTCCCTATTTATGGATTTACTCCACCTCCTCATCTTCAGGTCCGACAGACCGACAATGGCAATGGC
TCTTTCCTCCATGGCGAGTAAATCACTTCGATACAGGGACCGGAGCTCACTGTCTCCGCAGACTATCCTGGTCAAGGCCCGTTGCCTTCACTGGAAGTCATACAGAGACTGAATGCTACC
AATGGTACATTCTTGCCGCTGGATGAAGTCCAAGGAGACATATT
GTATGTTACCCTTGAGAAACCCAAGGGATTAATGTCTAATATCGATTGTCTCCCTCTCCAAGGATCGGCATGAAGA
AGCCCAAGCAGCTTTTCTTCTTCTACAACATCATAGATCCAAAGAAGTTCAAGCAGGTTCTCGCCAAATTGATATACCCACATATCACCA
GTAAGCCTACACGTATATGATTGTTGTCTC
GCTTCCGACCCGTCTTCGTTTAGCGACTTCCCAGCTTATCTGTACTACTTGCCCACAACCAAAAGCGTTGCTGAACGTTGCATGGACTTCCAAAGGTCTCAACAAGCTGAATGTTTTCGA
TAACAACCTGGACCCCTTCTTCAACATGGGCCAAGTTCCCGATGCTAATGCCCTTGGCGACAACAACCCTCCACAGAACTGGGTACCTGGCCTATATATGGACAAAACGGACGGCGTCTT
CCTCATTGCCTCCAAAGATTGGGCACCTATCGACTCCTTACTCGCCCAGATTCTTTCTTGGCTCGGTAGTTCGATTGTGGAGGTCCACAGACTCAAGGGCGCGCATCGAACGGGTGCGTG
GGAAGGCCACGAGCACTTTGGTTTCCTTGACGGCATT
GTATGTGGTTTTATATTAGTCTTGACATGGATTGCTAACTTACAGACATACAAAATTAGTCTCAGCCTGCTGTCGCCGGGTTT
GCTACTAGCATCTTCCCGGGACAGTCGCTCATTCTGCCTGGTACTATTCTGACTGGTGAGATTGGCGACCCCCTCGAGTTCTCCCGTCCTAGTTGGATGAAGTGGGGCTCTTTCTTGGCG
TTCCGACAGCTCCAGCAATTCGTCCCCGAATTTGATAATTACCTTCTTCATGA
GTACGTTCCCTTCAATTGCCCATGATATTATCATTGTGCTGACGATTATTACAGGGCGTCGGCTATT
CCAGATAGTTCTAGGACAGTGCAAGAGCGCGCAGATCTTCTCGGTGCTCGTATGATTGGCCGTTGGAAGAGT
GTTCGTTGCTTCGTTCTTGCATATGGATCACGACTGACCTTTATATAT
AGGGGACCCCTACTGACCTCGCCCCTGATTTCGACATACCCTCCATCGGTCCCGACTTCAATCTTAATAATAACTTCGACTTCAACCACCCAGCCCCGTTCAATCTAGCCGCTGATCAAT
CGTTCTGCCCCTTCTCAGCACACATTCGCAAAATTCGTCCCCGGGCGGATGAAGGTAACAACAACTTCGCAAACCAAATCATGCGCGCGGGTATCCCTTATGGCGATGATG
GTGAGTGAC
TTGATAATGTTTATGACTCGTCAGGCTAATTATCTCCTCAGTCACTGATGTAGAATGGGAAAATAATGCAACTAAATACGAACGTGGACTTGCATTCGGTAGGCAACTCGTTCATTAGTC
GAGGTCGTCCCCATCTAATGAGAGTTCTAGTGTCCTACCAGAGCGACATAGGCTCTGGATACCGCTTCCAACAGGTTGCTTGGGCTAATGACGTAAAGTAAGCTTATTCCTCATGATCTA
TCCCAACTCCAGATTTATTCAGCTGTCGACTCTAGCTTTGTCGGCGGCAAAATTGATCCCACCCCCGGATTTGATCCCATCTTTGGCCAGAACGGCGCAGGTCCAATCTTCTCCTCTGGA
ATTGACTATACTGACCCCAACCACGATCTCACCTTCATGAGCTTCGTACTCTCCCGAGGAGGAGAATATCTCTACAGTCCCTCTATGTCTGCCATCCTGAACCCGATCGCTGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGTGGAGCACTTTCTGCGTCGCTATCGCTTCTCTCGTTCCATACGCGTTGGTCCCTATTTATGGATTTACTCCACCTCCTCATCTTCAGGGACCGGAGCTCACTGTCTCCGCAGAC
TATCCTGGTCAAGGCCCGTTGCCTTCACTGGAAGTCATACAGAGACTGAATGCTACCAATGGTACATTCTTGCCGCTGGATGAAGTCCAAGGAGACATATT
GATCGGCATGAAGAAGCCC
AAGCAGCTTTTCTTCTTCTACAACATCATAGATCCAAAGAAGTTCAAGCAGGTTCTCGCCAAATTGATATACCCACATATCACCA
CGACTTCCCAGCTTATCTGTACTACTTGCCCACAA
CCAAAAGCGTTGCTGAACGTTGCATGGACTTCCAAAGGTCTCAACAAGCTGAATGTTTTCGATAACAACCTGGACCCCTTCTTCAACATGGGCCAAGTTCCCGATGCTAATGCCCTTGGC
GACAACAACCCTCCACAGAACTGGGTACCTGGCCTATATATGGACAAAACGGACGGCGTCTTCCTCATTGCCTCCAAAGATTGGGCACCTATCGACTCCTTACTCGCCCAGATTCTTTCT
TGGCTCGGTAGTTCGATTGTGGAGGTCCACAGACTCAAGGGCGCGCATCGAACGGGTGCGTGGGAAGGCCACGAGCACTTTGGTTTCCTTGACGGCATT
TCTCAGCCTGCTGTCGCCGGG
TTTGCTACTAGCATCTTCCCGGGACAGTCGCTCATTCTGCCTGGTACTATTCTGACTGGTGAGATTGGCGACCCCCTCGAGTTCTCCCGTCCTAGTTGGATGAAGTGGGGCTCTTTCTTG
GCGTTCCGACAGCTCCAGCAATTCGTCCCCGAATTTGATAATTACCTTCTTCATGA
GGCGTCGGCTATTCCAGATAGTTCTAGGACAGTGCAAGAGCGCGCAGATCTTCTCGGTGCTCGT
ATGATTGGCCGTTGGAAGAGT
GGGACCCCTACTGACCTCGCCCCTGATTTCGACATACCCTCCATCGGTCCCGACTTCAATCTTAATAATAACTTCGACTTCAACCACCCAGCCCCGTTC
AATCTAGCCGCTGATCAATCGTTCTGCCCCTTCTCAGCACACATTCGCAAAATTCGTCCCCGGGCGGATGAAGGTAACAACAACTTCGCAAACCAAATCATGCGCGCGGGTATCCCTTAT
GGCGATGATG
TCACTGATGTAGAATGGGAAAATAATGCAACTAAATACGAACGTGGACTTGCATTCGTGTCCTACCAGAGCGACATAGGCTCTGGATACCGCTTCCAACAGGTTGCTTGG
GCTAATGACGTAAA
CTTTGTCGGCGGCAAAATTGATCCCACCCCCGGATTTGATCCCATCTTTGGCCAGAACGGCGCAGGTCCAATCTTCTCCTCTGGAATTGACTATACTGACCCCAAC
CACGATCTCACCTTCATGAGCTTCGTACTCTCCCGAGGAGGAGAATATCTCTACAGTCCCTCTATGTCTGCCATCCTGAACCCGATCGCTGCGTAG

Retrieve as FASTA