Entry information : PoDyPrx03_PC15
Entry ID 6849
Creation 2009-06-19 (Christophe Dunand)
Last sequence changes 2011-11-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PoDyPrx03_PC15
Name PoDyPrx03_PC15
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoDyPrx03_PC15
start..stop
S start..stop
PoDyPrx02_PC15 722 0 5..479 36..511
PoDyPrx01_other 634 0 6..479 51..525
PoDyPrx01_PC15 634 0 4..479 40..516
PstrDyPrx01 460 2e-159 6..479 44..505
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3198015..3198039 25 N° 2 3197823..3197925 103 N° 3 3197659..3197762 104 N° 4 3197235..3197608 374
N° 5 3196978..3197174 197 N° 6 3196833..3196917 85 N° 7 3196554..3196782 229 N° 8 3196446..3196502 57
N° 9 3196324..3196390 67 N° 10 3196067..3196265 199  
complement(join(3196067..3196265,3196324..3196390,3196446..3196502,3196554..3196 782,3196833..3196917,3196978..3197174,3197235..3197608,3197659..3197762,3197823. .3197925,3198015..3198039))


exon

Literature and cross-references PoDyPrx03_PC15
DNA ref. JGI genome:   scaffold_07 (3198039..3196067)
mRNA ref. JGI transcript:   52170
Protein sequence: PoDyPrx03_PC15
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   479
PWM (Da):   %s   52877.84  
PI (pH):   %s   7.47
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLWGTLSVDYPGQGGLPSLEVIQSLNVTNGTFMPLHQIQGDILIGMKKPKELFFFYTIKDTRRFKQVLAKDIYPHITTAQLICGTCPQTSALLNVAWTSKGLKKLNVHGDTLDKFFNMGQAADASALGDNDPPTNWVPALLKDRTHGAFLIASNDWAPVDALLARIIGFLGTSIVEVHRLKGAHRPGAFAGHEHFGYLDGSQPAIGGFATSILPGQSLVLPGTILTGELGDPLALTRPSWMKWGSFMAFRQLQQFVPEFDEHLLQMASAIPDETRTKQERAELLGARMFGRWKGTPLDLAPDHDVPAIGSNSRRNNDFDYNHPPPFNIFANQSRCPFSSHIRKARPRADQANLNIFNQIMRAGLPYGDEVTDAEREKKTTTLERGFAFVSYQSDIGLGFRFQQVVWANNIHFPFLKDKTPGYDPIIGQNGANPVFSSGIDYKHPDQNSTYMSFILSRGGEYLYSPSMSAILDPIAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTGGGGCACTTTGAGCGTCGGTCTAGCGTCTCTCGTTCCTTACGCCTTGGGATTTTTACACGGCAAGTCAAGGCCCTTTCCCCGAAGGTCGGATGCTCATCTTCCCTAGACTATC
CCGGCCAAGGCGGGTTGCCTTCACTGGAAGTCATACAGTCCCTGAATGTCACCAATGGAACATTCATGCCGCTGCATCAGATTCAAGGAGACATCTT
GTAAGCCTTTCGTGCTTCTTCGT
GGAGCTCGTAAGATATAAGAACTCACCCCGATCGAAGAATTGGTATGAAGAAACCGAAGGAGCTCTTCTTTTTCTACACAATCAAAGACACCCGAAGGTTCAAGCAAGTCCTTGCGAAAG
ATATTTACCCGCATATTACCA
GTAAACCCCTTGTTTATCCCACTTTTGCATGGTTCTGACCCTTTGTTTAGCAACTGCGCAGCTTATCTGCGGTACTTGCCCACAAACAAGCGCGTTACT
GAACGTGGCATGGACATCCAAGGGCCTCAAAAAGCTCAATGTCCACGGAGATACTCTCGACAAATTCTTCAACATGGGTCAAGCCGCGGACGCTTCCGCCCTTGGTGACAACGACCCTCC
CACAAACTGGGTTCCCGCCCTTTTGAAGGACCGAACCCATGGCGCATTCCTCATCGCCTCCAACGACTGGGCACCTGTCGACGCCTTGCTTGCTCGAATTATAGGTTTTCTGGGCACCTC
AATCGTGGAAGTCCACAGACTCAAGGGCGCACATCGACCGGGTGCGTTTGCTGGCCACGAACACTTCGGATACCTCGATGGCATT
GTACGTGGTTTAATCGTGGGCCTTGTCCCGATTGA
CTAACCGATTCGCATTCGAACTCAGTCCCAGCCAGCTATTGGCGGATTTGCTACTAGCATCCTCCCTGGGCAATCCCTCGTTTTGCCTGGGACTATTCTGACTGGCGAGTTAGGCGACCC
TCTTGCACTTACTCGGCCTTCGTGGATGAAATGGGGTTCATTCATGGCATTTCGACAACTACAGCAATTCGTCCCTGAGTTCGATGAGCACCTTCTTCAGAT
GTATGTCTGCTTTATCCA
CTCGCAATTTGAGGCTACTGACTTGGATCATCATCACTACAGGGCATCGGCTATACCAGACGAAACAAGGACCAAGCAAGAACGCGCCGAGCTTCTTGGTGCCCGAATGTTCGGCCGCTG
GAAGAGT
GTTCGTTACGTTCATGTGCTTATGGAACGGCTACTTACCTTGATACATAGGGGACGCCTCTCGACCTTGCCCCCGATCACGACGTCCCCGCCATTGGCTCCAATTCTCGCCGC
AACAATGACTTTGACTATAACCACCCACCGCCATTCAATATCTTTGCTAACCAATCGCGCTGCCCCTTCTCTTCGCACATCCGCAAAGCCCGACCCCGTGCGGACCAGGCTAACCTCAAC
ATCTTCAACCAGATAATGCGGGCAGGTCTTCCTTACGGCGATGAAG
GTATGGGATTGGATCATGGGCTACGTTTGTGAAACTCATTTCTCTCTGTAGTCACTGATGCGGAGCGGGAAAAG
AAGACAACCACGCTTGAACGCGGATTCGCATTTG
GTGCGTAGCCTGCTCGTTTGTGAATGGAACGGTTGCCTTCTGACAATGGCCCTAGTATCCTATCAGAGCGATATAGGCCTTGGGTT
CCGCTTTCAACAGGTTGTCTGGGCCAACAACATTCA
GTACGCTTGTTCTAGATTATCCCCTCCAACGCGAGATTTGCTCACATATCGACTCTAGCTTCCCCTTCCTCAAGGATAAGACTC
CCGGATACGACCCCATCATCGGCCAGAACGGCGCGAACCCCGTCTTCTCCTCTGGAATTGACTACAAGCACCCCGATCAGAATTCCACTTACATGAGCTTCATCCTCTCCCGAGGGGGAG
AATACCTCTACAGCCCTTCGATGTCTGCTATCCTCGACCCAATTGCGGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTGGGGCACTTTGAGCGTCGACTATCCCGGCCAAGGCGGGTTGCCTTCACTGGAAGTCATACAGTCCCTGAATGTCACCAATGGAACATTCATGCCGCTGCATCAGATTCAAGGA
GACATCTT
AATTGGTATGAAGAAACCGAAGGAGCTCTTCTTTTTCTACACAATCAAAGACACCCGAAGGTTCAAGCAAGTCCTTGCGAAAGATATTTACCCGCATATTACCACAACTGCG
CAGCTTATCTGCGGTACTTGCCCACAAACAAGCGCGTTACTGAACGTGGCATGGACATCCAAGGGCCTCAAAAAGCTCAATGTCCACGGAGATACTCTCGACAAATTCTTCAACATGGGT
CAAGCCGCGGACGCTTCCGCCCTTGGTGACAACGACCCTCCCACAAACTGGGTTCCCGCCCTTTTGAAGGACCGAACCCATGGCGCATTCCTCATCGCCTCCAACGACTGGGCACCTGTC
GACGCCTTGCTTGCTCGAATTATAGGTTTTCTGGGCACCTCAATCGTGGAAGTCCACAGACTCAAGGGCGCACATCGACCGGGTGCGTTTGCTGGCCACGAACACTTCGGATACCTCGAT
GGCATT
TCCCAGCCAGCTATTGGCGGATTTGCTACTAGCATCCTCCCTGGGCAATCCCTCGTTTTGCCTGGGACTATTCTGACTGGCGAGTTAGGCGACCCTCTTGCACTTACTCGGCCT
TCGTGGATGAAATGGGGTTCATTCATGGCATTTCGACAACTACAGCAATTCGTCCCTGAGTTCGATGAGCACCTTCTTCAGAT
GGCATCGGCTATACCAGACGAAACAAGGACCAAGCAA
GAACGCGCCGAGCTTCTTGGTGCCCGAATGTTCGGCCGCTGGAAGAGT
GGGACGCCTCTCGACCTTGCCCCCGATCACGACGTCCCCGCCATTGGCTCCAATTCTCGCCGCAACAATGAC
TTTGACTATAACCACCCACCGCCATTCAATATCTTTGCTAACCAATCGCGCTGCCCCTTCTCTTCGCACATCCGCAAAGCCCGACCCCGTGCGGACCAGGCTAACCTCAACATCTTCAAC
CAGATAATGCGGGCAGGTCTTCCTTACGGCGATGAAG
TCACTGATGCGGAGCGGGAAAAGAAGACAACCACGCTTGAACGCGGATTCGCATTTGTATCCTATCAGAGCGATATAGGCCTT
GGGTTCCGCTTTCAACAGGTTGTCTGGGCCAACAACATTCA
CTTCCCCTTCCTCAAGGATAAGACTCCCGGATACGACCCCATCATCGGCCAGAACGGCGCGAACCCCGTCTTCTCCTCT
GGAATTGACTACAAGCACCCCGATCAGAATTCCACTTACATGAGCTTCATCCTCTCCCGAGGGGGAGAATACCTCTACAGCCCTTCGATGTCTGCTATCCTCGACCCAATTGCGGCATAA

Retrieve as FASTA