Entry information : AvePrx112-1A
Entry ID 6868
Creation 2009-07-13 (ester Simonetti)
Last sequence changes 2012-05-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-09 (Christophe Dunand)
Peroxidase information: AvePrx112-1A
Name AvePrx112-1A
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Aegilops
Organism Aegilops ventricosa (Goatgrass) (Triticum ventricosum)    [TaxId: 116981 ]
Cellular localisation N/D
Tissue type Roots
Inducer Cyst nematode infection
Repressor N/D
Best BLASTp hits
Perox score E-value AvePrx112-1A
start..stop
S start..stop
TaPrx112-1B 634 0 1..314 1..314
AvePrx112-1B 626 0 1..314 1..314
TmPrx03 622 0 1..314 1..314
AvePrx112-1M 622 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 150..359 210 N° 2 476..652 177 N° 3 750..1307 558  
join(150..359,476..652,750..1307)


exon

Literature and cross-references AvePrx112-1A
Literature Simonetti E, Veronico P, Melillo MT, Delibes A, Andrés MF, Lopez-Braga I. Analysis of Class III Peroxidase Genes Expressed in Roots of Resistant and Susceptible Wheat Lines Infected by Heterodera avenae. Molecular Plant-Microbe Interactions, 22:

DNA ref. GenBank:   EU595569
Protein sequence: AvePrx112-1A
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (291)
PWM (Da):   %s   32431.08 (30327.0)  
PI (pH):   %s   8.15 (8.21) Peptide Signal:   %s   cut: 24 range:24-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMGSASCISLVVLVALATAASGQLSSTFYDTSCPRALATIKSGVAAAVSSDPRMGASLLRLHFHDCFVQGCDASVLLSGMEQNAGPNVGSLRGFSVIDSIKTQLESICKQTVSCADILTVAARDSVVALGGPSWTVPLGRRDSTTASASLANSDLPGPGSSRSQLEAAFLKKNLNTVDMVALSGAHTIGKAQCSNFRNRIYGGDTNINTAFATSLKANCPQSGGNSNLANLDTTTPNAFDNAYYTNLLSQKGLLHSDQVLFNNDTTDNTVRNFASNAAAFSSAFTTAMIKMGNIAPLTGTQGQIRLSCSKVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGGTTCTGCTTCTTGCATTTCTCTGGTGGTGCTCGTGGCTCTGGCCACGGCGGCGTCGGGGCAGCTGTCATCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACC
ATCAAGAGCGGCGTGGCGGCCGCCGTGAGCAGCGACCCCCGCATGGGTGCCTCCCTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAA
GCAAGTTTCACATAATATATCGGCTCTTTT
TTCCTTAACTAACTTTCTTGAACTGCCCGGATTTCCGGATTTAACAAAAATTGTACCGTGAACTAATATGTTTATGTTGGCTACAGGGCTGTGATGCATCTGTTCTGCTGTCTGGCATGG
AACAAAACGCGGGTCCGAACGTGGGGTCGCTGAGGGGCTTCAGCGTCATCGACAGCATCAAGACCCAGCTGGAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACCGTCG
CCGCCCGCGACTCCGTTGTTGCC
GTAAGAACATCTTAGTACTATATTCAGTTTCATATATAATCGATGCTACGTAAAGCTAGTACTCCAGTGCTCAATTTCTTGCTTGGTCCGCATGCAG

CTTGGAGGGCCGTCATGGACTGTTCCACTCGGGAGACGGGACTCCACCACCGCAAGCGCCTCGCTGGCGAACAGTGACCTCCCTGGCCCAGGCTCTAGCCGGTCACAGCTCGAGGCTGCG
TTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGCGCGCACACCATCGGGAAGGCCCAGTGCTCCAACTTCCGGAATCGGATCTACGGCGGTGACACCAACATCAAC
ACTGCCTTCGCCACGTCTCTCAAGGCCAACTGCCCCCAGTCCGGCGGCAACAGCAACCTGGCGAACCTGGACACAACGACGCCCAACGCGTTCGACAACGCCTACTACACCAACCTCCTG
TCACAGAAAGGGCTCCTGCACTCGGACCAGGTGCTCTTCAATAACGACACCACCGACAACACCGTCCGCAACTTCGCGTCCAACGCCGCGGCCTTCAGCAGCGCCTTCACGACGGCCATG
ATTAAGATGGGAAACATCGCGCCGCTCACCGGGACGCAGGGCCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGGGTTCTGCTTCTTGCATTTCTCTGGTGGTGCTCGTGGCTCTGGCCACGGCGGCGTCGGGGCAGCTGTCATCGACGTTCTACGACACGTCGTGCCCCAGGGCTCTGGCCACC
ATCAAGAGCGGCGTGGCGGCCGCCGTGAGCAGCGACCCCCGCATGGGTGCCTCCCTGCTCAGGCTGCACTTCCACGACTGCTTTGTCCAA
GGCTGTGATGCATCTGTTCTGCTGTCTGGC
ATGGAACAAAACGCGGGTCCGAACGTGGGGTCGCTGAGGGGCTTCAGCGTCATCGACAGCATCAAGACCCAGCTGGAGAGTATATGCAAGCAGACCGTCTCCTGCGCCGACATCCTCACC
GTCGCCGCCCGCGACTCCGTTGTTGCC
CTTGGAGGGCCGTCATGGACTGTTCCACTCGGGAGACGGGACTCCACCACCGCAAGCGCCTCGCTGGCGAACAGTGACCTCCCTGGCCCAGGC
TCTAGCCGGTCACAGCTCGAGGCTGCGTTCCTCAAGAAGAACCTTAACACGGTCGACATGGTCGCGCTCTCAGGCGCGCACACCATCGGGAAGGCCCAGTGCTCCAACTTCCGGAATCGG
ATCTACGGCGGTGACACCAACATCAACACTGCCTTCGCCACGTCTCTCAAGGCCAACTGCCCCCAGTCCGGCGGCAACAGCAACCTGGCGAACCTGGACACAACGACGCCCAACGCGTTC
GACAACGCCTACTACACCAACCTCCTGTCACAGAAAGGGCTCCTGCACTCGGACCAGGTGCTCTTCAATAACGACACCACCGACAACACCGTCCGCAACTTCGCGTCCAACGCCGCGGCC
TTCAGCAGCGCCTTCACGACGGCCATGATTAAGATGGGAAACATCGCGCCGCTCACCGGGACGCAGGGCCAGATCAGGCTCAGCTGCTCCAAGGTGAACTCGTGA

Retrieve as FASTA