Entry information : PpaPrx[P]49 (PP00009G00420)
Entry ID 6949
Creation 2009-08-18 (Christophe Dunand)
Last sequence changes 2012-01-05 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2010-01-27 (Qiang Li)
Peroxidase information: PpaPrx[P]49 (PP00009G00420)
Name (synonym) PpaPrx[P]49 (PP00009G00420)
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx[P]49
start..stop
S start..stop
PpaPrx27 204 5e-65 12..243 40..298
PpaPrx16 171 2e-52 2..241 31..281
PpaPrx52 171 2e-52 8..243 28..275
PpaPrx06 171 2e-52 8..243 28..275
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 594952..595107 156 N° 2 595263..595433 171 N° 3 612827..613231 405  
join(594952..595107,595263..595433,612827..613231)


exon

Literature and cross-references PpaPrx[P]49 (PP00009G00420)
DNA ref. Phytozome 12:   scaffold_9 (594952..613231)
mRNA ref. JGI transcript:   114185
Protein sequence: PpaPrx[P]49 (PP00009G00420)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   243
PWM (Da):   %s   26816.94  
PI (pH):   %s   8.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFCSADALVQGFYSKKCPNKETILFDTLKDLDANDGDLPPILLLHFQDCFVRDGDASVLLDVAKSEKTAAPGARLLGFEAVEALKSAVERACPGVVSCADILAYAARDSGNISKALEASQFLPRSKFNISQLVVNFKVQRLTKKEMIVLSSTHTINKTACHHIDNRIYYYLSKFGVDLNIIANLVRKMKKKCCSFGLQKCIVNLYTNICIKFDSKYSSNLVAKRGMLVLDQVLLNDVSMHPLV*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Large introns and 3' is missing. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTGCAGCGCAGATGCGCTGGTTCAAGGGTTCTACAGCAAAAAATGTCCCAACAAGGAGACGATCCTCTTCGACACATTGAAAGATCTTGATGCCAACGACGGGGACCTTCCTCCT
ATCCTCCTACTTCACTTCCAAGACTGCTTCGTTCGA
GTGAGAGGCCTGTCGAGATGTTTAATTCGTCAAGGTTTGTGATCATCGATCATGATATCATACTTGCAGAATAGAAGAATTAAT
ACGATTCGAGGGGCGTAATGTATTTTTGAGTATCTGATTCGCGAAACTTAACGTTGCTCCCTTTTCTGCAGGACGGCGATGCGTCTGTGCTTTTGGACGTTGCTAAGTCGGAGAAGACAG
CCGCGCCTGGCGCACGTCTTCTGGGTTTTGAGGCCGTTGAGGCGCTCAAGTCGGCAGTAGAGAGAGCCTGCCCAGGCGTAGTTTCATGTGCTGATATATTGGCATACGCAGCACGTGATA
GT
GTGTTCCAAAAACATTATGTGTTATGAAAATTGTATCAGAACTATTTTGTGCATGATCTACGTGCTATAGCCTCTAGAACCGTACGAAAGCCTAGGAGGTACAANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTACATTTATTGCATTATCAAAATCTT
GGGATCTATATGTTTAGTTGATTGCATTGACNNNNNNNNNNNNNNNNNNNNNNNTCATTGAAGAGATAGTACAATCTATTGTCCTTGAGGAGGAGATGCAAAAGAAAAAGAAGATTAGTT
CTCTATTTTTTGCTTTAATAGTGCTTGCAAGAGGAAAAAAATTCTTAAAGAAAGACCATCTACAATAAAAATAGAAGCTTAAAATTGATAAGTCTAAAAGTATTTATAGGACATGTAGAC
AAAAGAGGCATTGAAAAGGTGATACAAAATGTCCAAAATAAATAGCAATGGTGTAATAAATATTAGAGTTGCTATTATTCTTTCAACTTTAGTGGCATCATTTAATTCAAAAACAATAAT
TGCATTGTTATCTTAATCATGGCATTATGTATGTATTAATAATGCAATAGATGTTCACATCCAAAGAGATAGGAATAACCTTCTTAATTTTTAGAAAAATATAACTATCCAACTCTAAGG
CTATGATGGTGGCATTAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTAAAGATAAAAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCATTCAATTTCAATAATCGAGATCAGTAGATCCTAAGCCAAGAAAAAAAATTAAGGAGATAAATCGAG
GTCTTCAAGATTCTCTAGTAAATCGGGTGGAATGTGTCTAAGCCGTTCTTACCAGGAGTCAACAAAAAGGAAAAGGACCAATTCAATATTTGGGTGAGCTTGATGCAAAGGGCCAATTTG
ATCAAATTACGGGGACATCCAATCCAGGTCCTGTTACAGGCCTCTTATCCAATATGAGATCTGACTCGGTTGGACAATCCAATGAGGTCCTGATGTTAGGGACATAGTCCTTAGAACCTT
CTAGAGACAAGTTCATAGAAACCTTCTAGAGACAAGTTTCTAGAACCTTCTAGAAGCAAGTCTCTGGAACCTTCTAAAAGCTTCTTAGTTGGTAGAAGATGTTAGGAACATAGTCCTTAG
AACCTTCTAGAGATAAGTTTCTAGAATCTTCTAGAGATAAGTTTCTAGAATCTTCTAGAAGCAAGTCTTTGGAACCTTCTAGAAGTTTCCTAGTTGATAGAAGTTGCTTGAGAAGCTTCC
TAAATAGGGGTATATATCAAAATCGAGGCAGAAGAGTTCTTCAGTCTCGACAACACATCTCTTGGAGCTCTAGCTCACTTCTCTGGTCTTGTTCTTATATTCATCTGATTAATCTAGTTC
TTTCCAGTTCTTCTTGAACTTCTTATTAGATCTCGAGTCTGTATTTTTGTGTCCGTGACAGTTTGTCAAGACTTCACTCACCTTAGATATCAGAGTTAGTTTCTTCCTCATTAGAGTGCG
GATTACTCCTCTGCTTGGAAGTGTACTAGGATTTTAGAGGTTGCGGATTACCCTCCTCTAAACTGATACTTCTTTTGTTACAATATTGGAGTCTTATTCTTGTTCGAGAGAGTGGATTAC
TTCTTTTCTTGAAGCTCTTAAGGCATTTTAGAAGTTGCAAAGTACCCTCCTCTAAACCAATATTGTTTTCTTGTAGAGTCATTTGTGTCCTTCTCTTAGAATGGCCGGAGGCCAAGACNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTTGTTCACGAAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
TTGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTTTGACAATAACTTCTTTCTGAAGCTTGCTCACCCAAAAATATAAGAAAGGGAGAGAGCACTACCAAAATTCGTAGTTGATGTAGTTATTTTCTCCAAGATAAAATAGAATTTTTTTAG
TAGCCATAGTTTGGTGTTTTGATATGGATAGCCAAGAGATAGATACTATGCCAGTCAGATTATCTCAACCGACTAGCTCACGAAGGCGACCCCGAGATGAAGAACTGCCTACACCACGAT
GACAACGAAGGATACCGAGTAACCGATCACTGGTGATTGTATTTGAGTCCGAGCCTGCTTACGATGGTCAATCAGAAGGCTTGTTTGTAGGACAATTTCACAATGAGGACACGGAAGTTC
ATCCTTGGTCAGAAGTTGAAGGAGTGGGCCACTATCATTGGCTTCAAGGGCCGATGAACCACTTGCCTCGTGAACAACAGTTAGAGTTCATAGCATACCTGGTCGTCCTTAGAACCTTCT
AGAGACAAGTTTATAGAAACCTTCTAGAGACAAGTTTCTAGAACCTTCTAGAAGCAAGTCTTTGGAACCTTCTAGAAGTTTCCTAGTTGATAGAAGTTGCTTAAGAAGCTTCCTAAATAG
GAGTATATATCGGAATCAAGGTTGAAGAGTTCTTCAGTCTTGACAATACATCTCTTGGAGCTCTAGCTCACATCTCTGGTGTTGTTCTTGTATTCATCTGATTGATCTAGTTCTTGCCAG
TTCTTTTTGAACTTCTTGTTAGATCTCGAGTCTGTATTTCTGTGTCCGTGACACCCGATTATGGAGGCTTCAGTTCCATTTCAAGCTATTCCATTCTCTATGCCATTTTGGAGAAACGTT
CTTTCCGTGGAAAGATCCTCTTAGAAAAGGGAATTCCATAGAAGCGCGGTTTGCTGTTCCAATTTGGAGTCGAGGGCGGAAGAGTAGGGGACCTCACGGAGTTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGATGGCATTCAAGGAGATTAGGGGATTTTGGGGTTGGAGAGCTAGCTTCAAGCTCCTTCAAAAGGTGTAAGACTTAGTTTTAGAGGGTTCGGGA
GGACTTTGCAATTGTTGTTCAAAGTCAGTGTTTGTATTGGTGATTTGGATTTTTTGCAATAAAGTTAGGGTTAGTACTCTTGACTATTTTCTAAAATTAGAGAAATATTTGTAGTTGAAA
TTTTAGAAGTATCTAGTTGGTTGAGTATGCCAAGTGCTTGCAAAAATTTGTATTAATCTAATGGTACGGATAGAGGATATTTGATCATTAATGTAAAGAGGTATCAGAAGTTGGCAGATT
GGGGTTGTTTAGGGTTTCTGCAATATTTGGAGATCTACTTGCTGGAATAAGGTGAATTTTAGCATGTTAAGTCGAGGACTTAAAAGAGGAGCTGCACACAAATTTTTAATGAGAACTAAC
AAATGAAAAAGGAGAAATTGTAATTCAAAGTTCGTCATCAACTTTCTAAGCAGTGGTCAAGGGACATCAGTGTAGATTTACAGCGTTTTCTTGCAATCTGTAAGTTGGATTGGATTGAAA
CTTCTTGAACATTTAAAAGACTTTCAAAGACACTAGTGGTAGAAGTTTTACAACAATCAAACAATCAGATTGAGAATAACAGCTTGACGAAGCTTGCTATCTAGGATTAGGGTTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAACTTGTGCTTATAATATCTTGAAGTTATTAAAAATAGTA
TTTCTAAGTACTTTGTATTGGGATTAAACTTTTACATTGAAATCCGAAATAGTTTACATTTAGATAGTTGAAATCTACTAGAATACTTAGATACTTGCAAAACATTGTTTCATCTTCCAC
AACGAGATGCCTGGTGCATTTTTAAGCAAGATAGCACGTAATACAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATCTAAATTAAGTTGAAGAATAATAAGTCTTTGTTATAAAAGAAACAAGGT
CAAAGGAAGATTGCATTCTATCTTCTATCTTTCTTTGTAGCTTCCATGTATTTATGACACTAAGGAGACGAAGAACCAACAACCAACAGATTCAACTCAAGAGCTTTCATTTGTAAACTT
ACCAGACGAGACATTGAAATTGTCACAACCTTCAAGATGACAAAATCAAGATGAAGATCTTCAAGAATGACATGTCTTTCCTTAAATAGATGGCAAGATACAATGTGTTTGGTATCACGA
CTTTGGAAGAGACTCCTAATGTTTGGTGATTTTATTAAAAGTAGAAACAACTCTTAATGATATTTCAAATGTTTTCTTTGAAGGAAGTTATAAAGGCTTCAACAAAATCCAAATAATAAG
GTGGTCTTCTTGCCTTGGTATGGGATACTATCGATGGCTGAGAGGGCCTATCAACTATCTTCAAAGAAAACAAAGATCGGAGTATGTTGCAAATATAATTCACTGCATCTTGGATTTTCT
CAACATATGAAGATAGCTCCTTGTGGAACTCATCCTTAAAAGGAGGGGAGGTAATATTATGGATATACACATGTAAATCAATAATTACCTATATGATTAAATAAAATTAAGTTAAAGTAT
GTTAATTCCATAATATCCTCTATAAAAGCTTCCTAGAAGCTTTATAGATACCACTTTGACTTTATAAATGTCTATAATTGACTTTTTAGATTAAAAACGTGGTCAACAAATTGGCCATGT
ACTACATATATTAGGTAGCTTGAAGAACAAGCTAACTATATGGCCTACACATAAAAAACTTGCCTTGTAAGGTAAGGCATGTGTCTTGCAAAGCCAACACATATTAGGGATCCTATAGAA
TATCACTACATAGATTTTAGTTAGATAGTATATATAAAAGCAAGAGTGAAGCTTTCTTCATTTTTGTCAACTCCTTTTTTGCTTTTAGTTTAGTTTTAAAAGTCTAGTTTCTTTTTCTTT
TAGTAATAGCGATTCTAGTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAAATTTTCTAGGTTTATGCATCTTTTTGTAGTTCATGTCCTTGACA
AAAGGAGAAGGATAAAATACTTATATGTGAATCATGTATTATTGGCAAGGCCCATAGATAGCCTTTCTTACACAAGCACAAGCATGCCAATGGTATTTTAGATGTAATAGTATTGATCTT
GGTTATTTTGATATATTTAGATTTAATGGTGTCAAAAGATTAATTGTGTAGATTGATAAATATTCAAGCTATTGTAGCCTTGTATTTCTTCAATCTAAAGACCAAGTACATATTGCTTAT
AAGACTTATAAAGTAGAGGCATAAAGATAAATTTAAAGAAACATAAAAAAAATTCTTATTAATCAAGGCATTGAATTCTTGAATAGTAATCTTGGTTTTCACTTCAAAGGCTTTTAACAC
ATTTTATTTGTAAGAAATGATGCCTATCATGTTTTCATAATATACCTTATTTTTGTAACACAATGTAAAAATTGCCTTTGATCTAGAATTCATGGTATTTGCTAGAAGATAAGATGGTAA
TATCTCCAAGGCCTTAGAAGCATCACAATTTTTGCCAAGGTCTAAGTTTAACATCTCTCAACTTGTAGTAAACTTCAAAGTCCAAAGATTGACAAAGAAAGAAATGATTGTGCTCTCTAG
TACTCATACAATCAACAAGACTGCATGCCACCACATTGACAATAGGATTTACTATTATCTAAGCAAGTTTGGAGTAGATCTTAACATCATTGCCAATCTCGTCAGGAAGATGAAGAAGAA
ATGTTGCTCTTTTGGACTTCAAAAGTGCATTGTCAACTTGTACACCAACATTTGTATAAAATTTGACTCCAAATACTCTAGCAACTTAGTAGCTAAGAGGGGCATGTTAGTTTTGGACCA
AGTGTTGTTGAATGATGTGTCAATGCACCCTTTAGTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTGCAGCGCAGATGCGCTGGTTCAAGGGTTCTACAGCAAAAAATGTCCCAACAAGGAGACGATCCTCTTCGACACATTGAAAGATCTTGATGCCAACGACGGGGACCTTCCTCCT
ATCCTCCTACTTCACTTCCAAGACTGCTTCGTTCGA
GACGGCGATGCGTCTGTGCTTTTGGACGTTGCTAAGTCGGAGAAGACAGCCGCGCCTGGCGCACGTCTTCTGGGTTTTGAGGCC
GTTGAGGCGCTCAAGTCGGCAGTAGAGAGAGCCTGCCCAGGCGTAGTTTCATGTGCTGATATATTGGCATACGCAGCACGTGATAGT
GGTAATATCTCCAAGGCCTTAGAAGCATCACAA
TTTTTGCCAAGGTCTAAGTTTAACATCTCTCAACTTGTAGTAAACTTCAAAGTCCAAAGATTGACAAAGAAAGAAATGATTGTGCTCTCTAGTACTCATACAATCAACAAGACTGCATGC
CACCACATTGACAATAGGATTTACTATTATCTAAGCAAGTTTGGAGTAGATCTTAACATCATTGCCAATCTCGTCAGGAAGATGAAGAAGAAATGTTGCTCTTTTGGACTTCAAAAGTGC
ATTGTCAACTTGTACACCAACATTTGTATAAAATTTGACTCCAAATACTCTAGCAACTTAGTAGCTAAGAGGGGCATGTTAGTTTTGGACCAAGTGTTGTTGAATGATGTGTCAATGCAC
CCTTTAGTTTAA

Retrieve as FASTA