Entry information : SmPrx04-1_122 (SmPrx04a_122)
Entry ID 6953
Creation 2009-08-18 (Christophe Dunand)
Last sequence changes 2009-08-18 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: SmPrx04-1_122 (SmPrx04a_122)
Name (synonym) SmPrx04-1_122 (SmPrx04a_122)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx04-1_122
start..stop
S start..stop
SmPrx04-2_114 664 0 1..323 1..323
CmichPrx14 377 1e-131 21..320 40..339
PabPrx64 372 5e-130 7..320 8..327
SmPrx80-1_13 372 7e-130 20..322 25..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 148732..148935 204 N° 2 148315..148675 361 N° 3 147851..148257 407  
complement(join(147851..148257,148315..148675,148732..148935))


exon

Literature and cross-references SmPrx04-1_122 (SmPrx04a_122)
DNA ref. Phytozome 12:   scaffold_122 (148935..147851)
mRNA ref. JGI transcript:   133931
Protein sequence: SmPrx04-1_122 (SmPrx04a_122)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (302)
PWM (Da):   %s   35096.68 (32888.5)  
PI (pH):   %s   7.11 (7.13) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSSGLCFSLTVLLLLMLVTSELTVDYYKRTCPHAESILRQVMVQKIREAPTTAGATLRLFFHDCFVDGCDASVLVSSTPGNKAERDEEINHSLAGDAFDAVHRAKAAVEKICPGVVSCADVLAIITRDLVQLVGGPFWEVRKGRKDGRLSMASRVGRNLPTSTASINELTRLFASKGLNEIDLIALSGAHTIGFAHCTEFTNRIYNFNGTRAGDPSMNPGFLGELRRACPPRNGNPDVVASMDAATPFQFDNSYYRSMQRGLGLLTSDQELLTNARTRSVVDAFASSQDLFYEVFAASMDKLGNVGVKNETNGVVRKECHRT

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3). No EST
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCATCTGGCCTGTGTTTCAGCTTAACCGTGTTACTTCTGCTCATGCTTGTAACTTCAGAGCTGACAGTGGACTACTACAAGCGGACTTGCCCGCATGCCGAGAGCATTCTCAGA
CAGGTGATGGTTCAAAAGATAAGGGAAGCACCAACAACAGCTGGAGCAACACTGCGGCTCTTTTTTCATGACTGCTTCGTTGAC
GTAAGTTGTCCTTTCTCCTGAGGTTCTTGAGTTTTC
TTATTTGTTTTTGAGGCCAGGGATGTGATGCTTCGGTCCTCGTTTCGTCAACTCCTGGCAACAAGGCTGAAAGAGACGAGGAGATAAATCATTCATTAGCGGGAGATGCCTTTGATGCAG
TTCATCGAGCTAAAGCAGCAGTGGAAAAGATTTGTCCCGGTGTGGTCTCTTGCGCTGATGTTCTGGCTATCATCACGAGGGATTTGGTTCAGCTAGTTGGTGGTCCTTTCTGGGAAGTCA
GGAAAGGCCGTAAAGATGGAAGGTTGTCTATGGCTTCCCGGGTTGGCCGCAATCTCCCGACTTCCACAGCATCTATCAACGAATTAACCAGGCTGTTCGCTTCCAAGGGCCTCAATGAAA
TCGATCTGATAGCGCTCTCTG
GTAAGCACTCTCTCAGTGCTTTTTAAGCTGCTCGCTAATCCCTCGTTCTTCTTCCAGGTGCTCATACAATCGGCTTTGCACACTGCACGGAATTCACGA
ACAGGATCTACAACTTTAACGGCACCAGAGCCGGCGATCCAAGCATGAACCCGGGCTTCCTCGGCGAACTACGACGAGCTTGCCCTCCGCGAAATGGAAATCCCGATGTGGTAGCAAGCA
TGGACGCAGCAACACCCTTCCAGTTCGACAACTCCTACTACCGGAGCATGCAGAGAGGTCTGGGCCTTCTCACCTCCGACCAGGAGCTCCTTACAAACGCAAGAACTCGCAGCGTCGTGG
ACGCATTTGCCAGCAGCCAGGATCTCTTCTACGAAGTCTTTGCGGCTTCCATGGACAAGCTCGGAAACGTCGGTGTGAAGAACGAGACGAACGGGGTGGTAAGAAAAGAGTGCCACAGAA
CTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCATCTGGCCTGTGTTTCAGCTTAACCGTGTTACTTCTGCTCATGCTTGTAACTTCAGAGCTGACAGTGGACTACTACAAGCGGACTTGCCCGCATGCCGAGAGCATTCTCAGA
CAGGTGATGGTTCAAAAGATAAGGGAAGCACCAACAACAGCTGGAGCAACACTGCGGCTCTTTTTTCATGACTGCTTCGTTGAC
GGATGTGATGCTTCGGTCCTCGTTTCGTCAACTCCT
GGCAACAAGGCTGAAAGAGACGAGGAGATAAATCATTCATTAGCGGGAGATGCCTTTGATGCAGTTCATCGAGCTAAAGCAGCAGTGGAAAAGATTTGTCCCGGTGTGGTCTCTTGCGCT
GATGTTCTGGCTATCATCACGAGGGATTTGGTTCAGCTAGTTGGTGGTCCTTTCTGGGAAGTCAGGAAAGGCCGTAAAGATGGAAGGTTGTCTATGGCTTCCCGGGTTGGCCGCAATCTC
CCGACTTCCACAGCATCTATCAACGAATTAACCAGGCTGTTCGCTTCCAAGGGCCTCAATGAAATCGATCTGATAGCGCTCTCTG
GTGCTCATACAATCGGCTTTGCACACTGCACGGAA
TTCACGAACAGGATCTACAACTTTAACGGCACCAGAGCCGGCGATCCAAGCATGAACCCGGGCTTCCTCGGCGAACTACGACGAGCTTGCCCTCCGCGAAATGGAAATCCCGATGTGGTA
GCAAGCATGGACGCAGCAACACCCTTCCAGTTCGACAACTCCTACTACCGGAGCATGCAGAGAGGTCTGGGCCTTCTCACCTCCGACCAGGAGCTCCTTACAAACGCAAGAACTCGCAGC
GTCGTGGACGCATTTGCCAGCAGCCAGGATCTCTTCTACGAAGTCTTTGCGGCTTCCATGGACAAGCTCGGAAACGTCGGTGTGAAGAACGAGACGAACGGGGTGGTAAGAAAAGAGTGC
CACAGAACTTGA

Retrieve as FASTA