Entry information : LePrx75 (LeTAP2 / TMP2 / Solyc02g079510.2.1[2.3])
Entry ID 7
Creation 2006-12-27 (Christophe Dunand)
Last sequence changes 2012-05-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-08-26 (Christophe Dunand)
Peroxidase information: LePrx75 (LeTAP2 / TMP2 / Solyc02g079510.2.1[2.3])
Name (synonym) LePrx75 (LeTAP2 / TMP2 / Solyc02g079510.2.1[2.3])
Class Class III peroxidase    [Orthogroup: Prx065]
Taxonomy Eukaryota Viridiplantae Streptophyta Solanaceae Solanum
Organism Lycopersicon esculentum (Tomato)    [TaxId: 4081 ]
Cellular localisation N/D
Tissue types Callus
Cell culture
Crown gall
Inducers Abscissic acid treatment
Suberization
Repressor N/D
Best BLASTp hits
Perox score E-value LePrx75
start..stop
S start..stop
StPrx52 669 0 1..363 1..358
StPrx72 664 0 1..363 1..363
LePrx76 661 0 1..363 1..364
NtPrx27-1A 526 0 21..363 21..358
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 315..656 342 N° 2 1653..1850 198 N° 3 1977..2528 552  
join(315..656,1653..1850,1977..2528)


exon

Literature and cross-references LePrx75 (LeTAP2 / TMP2 / Solyc02g079510.2.1[2.3])
Literature Roberts E., Kolattukudy P.E.; Molecular cloning, nucleotide sequence, and abscisic acid induction of a suberization-associated highly anionic peroxidase. Mol. Gen. Genet. 217:223-232(1989).
Protein ref. UniProtKB:   P15004
DNA ref. GenBank:   X15854.1
Protein sequence: LePrx75 (LeTAP2 / TMP2 / Solyc02g079510.2.1[2.3])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (343)
PWM (Da):   %s   38391.93 (36365.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.37 (4.31) Peptide Signal:   %s   cut: 21 range:21-363
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFRLSLLSLAVSLVALALAGVAIYRNTYEAMIMNNGSLLQNISPDIDSLESGEVSILILNDKKKNSDKYLSQQLTQESCVFSAVKGVVDSAIDNETRMGASLIRLHFHDCFVDGCDGGILLDDINGTFTGEQNSPPNNNSVRGFEVIAQAKQSVVDSCPNISVSCADILAIAARDSLAKLGGQTYTVALGRSDATTANFSGAINQLPAPSDNLTVQIQKFSDKNFTVREMVALAGAHTVGFARCSTVCTSGNVNPAAQLQCNCSATLTDSDLQQLDTTPAVFDKVYYDNLNNNQGIMFSDQVLTGNTTTAGFVTTYSNNVTVFLEDFAAAMIKMGNLPPSAGAQLEIRDVCSRVNPTSVASM*

Retrieve as FASTA  
Remarks Complete sequence from 10 ESTs and genomic (chromo 2, introns 1 and 2). Strain="Castlemart II".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTCGTTTGAGCCTTTTGAGCCTTGCGGTGAGCCTTGTGGCACTTGCACTCGCAGGTGTTGCCATTTATAGAAATACTTATGAGGCCATGATCATGAATAACGGATCACTCCTC
CAAAATATCTCTCCAGATATCGATTCGTTGGAATCAGGCGAAGTCAGTATTTTAATTTTAAATGATAAGAAGAAAAATTCAGACAAATATTTGAGTCAGCAATTAACTCAGGAGTCTTGC
GTTTTCTCAGCTGTGAAAGGAGTTGTGGACAGTGCCATTGATAATGAAACGCGCATGGGAGCTTCTCTCATTCGTCTACATTTCCATGACTGCTTTGTTGAT
GTAAATATTCTTTCGTCC
TTTTTCTCCCGCTCAATATTTTATAATAATGTAATTTTAAGGTTGATATAATCGTATGAATAAGTATTTACTTATTTTTTATCATAAATTTTAAATTTTTTAATTTTAACTTTTAAAATC
TCTTACAACTAAACGCTTAATATAAAAATAGAAAGATCGGATTTTTTATTTTATTTTTGAGGACATATTAAAAAAATAAAACAGTATGTTAGGTGTAGTATATAAATTGAATCCGAGTCC
TCCTTTCTCTTATTAAAATTAAAAGTAAAAACCTGGCTCCATGGACCATGGTCATATAATATTATTTAATGTAAATATGTGTAAGTGGTCCGAAAGGAAAGTGATCCGTAAAATTATTTG
AAAAATCTGACGGAACGAATTTCAAAACATGCTTATGAAAACTGTGTGGGTTTTTATTAGTGTAGTAGTTGTAAAGTTGCATCATGAATGGTACCATCTTCTTGTAATTTGTGAAATGAA
CAGTTTCTTATTAGTTTTTTCTGCCTTACAACTCTTTTTTATCAGCCACTTGGCTAATTTTGGGCAACTTTATCTCCTTTATCTCACTCATCACTTTCTCTTTTGCTCGATTCTCTTTGC
ATATTTTAGATATATATAAATCTAGTCCCATTTTTATATACCTTAAATAAATAGTCTGTTTTACTCATTTTCATTCTATCTAGCATGCTCTTTTTCTATATTAATATATTGATAAAAAAA
ATATATGATTTTACAATATCTAACTTAAAATCTAATATAAAATTATTGATTAGTAAGACAATATTTAATTTGTTTGAACTATAAGGAGAACTAGTAAATATAGTAGGATTATTTATCTAA
TTAGGTTTGTTTTTTCTTTAAATAAATTCATGTTAAATTAAACCACATCCATATAAATTGAAGCAATAGAGTAACTAATTATGTATACATATAATTGACTAATTACAGTTATGTTTTTGG
TTTGGAAAAAAAAAACAGGGTTGTGATGGAGGTATTCTGCTAGATGATATTAATGGAACATTCACCGGGGAACAAAACTCACCACCCAACAACAACTCAGTCAGAGGCTTTGAAGTGATA
GCACAAGCTAAACAAAGTGTTGTAGATTCATGCCCCAACATATCTGTATCTTGTGCTGATATTTTAGCTATTGCTGCTCGTGATTCCCTTGCTAAA
GTAAGTCCTATTGCTCAATTTTTA
GTCAAAGTTACTATTTTTAATTTAGCTTTACACTACATGTTTAATTAACTTATATCATATGATCAATAGTAAGTTAAACTCTATTTTATTGGTATTTGACAGTTAGGAGGACAAACTTAT
ACCGTTGCACTAGGGAGAAGCGATGCTACAACAGCCAACTTTAGTGGTGCTATAAATCAACTTCCAGCTCCATCCGACAACCTAACTGTTCAAATACAGAAATTCAGCGACAAAAATTTC
ACTGTCCGTGAAATGGTGGCACTAGCTGGCGCGCACACGGTAGGTTTCGCCAGGTGTTCCACAGTTTGCACCAGCGGTAACGTTAATCCTGCCGCACAACTCCAATGCAACTGCTCCGCC
ACGCTAACTGATTCCGATTTGCAACAATTGGATACAACTCCTGCTGTGTTCGACAAAGTTTACTATGATAACTTAAACAACAACCAAGGGATAATGTTCTCGGATCAAGTTTTGACTGGG
AATACTACAACTGCTGGTTTTGTAACCACTTATAGCAACAATGTTACTGTTTTTCTTGAAGATTTTGCTGCTGCTATGATCAAAATGGGGAATTTACCTCCCTCCGCTGGCGCTCAATTG
GAAATTCGCGATGTTTGCAGCAGGGTTAATCCCACTTCTGTGGCTTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTCGTTTGAGCCTTTTGAGCCTTGCGGTGAGCCTTGTGGCACTTGCACTCGCAGGTGTTGCCATTTATAGAAATACTTATGAGGCCATGATCATGAATAACGGATCACTCCTC
CAAAATATCTCTCCAGATATCGATTCGTTGGAATCAGGCGAAGTCAGTATTTTAATTTTAAATGATAAGAAGAAAAATTCAGACAAATATTTGAGTCAGCAATTAACTCAGGAGTCTTGC
GTTTTCTCAGCTGTGAAAGGAGTTGTGGACAGTGCCATTGATAATGAAACGCGCATGGGAGCTTCTCTCATTCGTCTACATTTCCATGACTGCTTTGTTGAT
GGTTGTGATGGAGGTATT
CTGCTAGATGATATTAATGGAACATTCACCGGGGAACAAAACTCACCACCCAACAACAACTCAGTCAGAGGCTTTGAAGTGATAGCACAAGCTAAACAAAGTGTTGTAGATTCATGCCCC
AACATATCTGTATCTTGTGCTGATATTTTAGCTATTGCTGCTCGTGATTCCCTTGCTAAA
TTAGGAGGACAAACTTATACCGTTGCACTAGGGAGAAGCGATGCTACAACAGCCAACTTT
AGTGGTGCTATAAATCAACTTCCAGCTCCATCCGACAACCTAACTGTTCAAATACAGAAATTCAGCGACAAAAATTTCACTGTCCGTGAAATGGTGGCACTAGCTGGCGCGCACACGGTA
GGTTTCGCCAGGTGTTCCACAGTTTGCACCAGCGGTAACGTTAATCCTGCCGCACAACTCCAATGCAACTGCTCCGCCACGCTAACTGATTCCGATTTGCAACAATTGGATACAACTCCT
GCTGTGTTCGACAAAGTTTACTATGATAACTTAAACAACAACCAAGGGATAATGTTCTCGGATCAAGTTTTGACTGGGAATACTACAACTGCTGGTTTTGTAACCACTTATAGCAACAAT
GTTACTGTTTTTCTTGAAGATTTTGCTGCTGCTATGATCAAAATGGGGAATTTACCTCCCTCCGCTGGCGCTCAATTGGAAATTCGCGATGTTTGCAGCAGGGTTAATCCCACTTCTGTG
GCTTCTATGTGA

Retrieve as FASTA