Entry information : SmPrx19-1_79 (SmPrx19a_79)
Entry ID 7004
Creation 2009-10-06 (Christophe Dunand)
Last sequence changes 2009-10-06 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx19-1_79 (SmPrx19a_79)
Name (synonym) SmPrx19-1_79 (SmPrx19a_79)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx19-1_79
start..stop
S start..stop
SmPrx19-2_30 647 0 1..324 1..324
PpaPrx47 338 2e-116 27..324 27..326
PtaPrx03 328 7e-113 27..324 15..321
PabPrx36 325 3e-111 6..324 7..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 570337..570561 225 N° 2 570061..570249 189 N° 3 569835..569997 163 N° 4 569360..569757 398
complement(join(569360..569757,569835..569997,570061..570249,570337..570561))


exon

Literature and cross-references SmPrx19-1_79 (SmPrx19a_79)
DNA ref. Phytozome 12:   scaffold_79 (570561..569360)
mRNA ref. JGI transcript:   125363
Protein sequence: SmPrx19-1_79 (SmPrx19a_79)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (299)
PWM (Da):   %s   35061.06 (32517.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.59 (8.59) Peptide Signal:   %s   cut: 26 range:26-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSRGNSVLAVVFLLLFAGNVEVIGQSSGLRVGFYSRSCRNVEPIVRGVVQRFLGRDRTVTAALLRLFFHDCFVRGCDASLLLNSTRTNRSEKEHGANGSVRGYDLIDAAKAEVERQCRGVVSCADIVALATRDSIALAGGPDYPVPTGRRDGRISIVNDADVLPDPNSNANGAIQAFANKGLTPQDLVLLLGAHTVGITHCGFFRHRLFNFRGTGRADPSMDPALVRQLQRACTSDSVEVFLDQGTPFRVDKVFFDQLVSNRAILIIDQQLRVEQRTDDIVRALANGTLNFNAAFAQSMTNMGNLDVLTGTRGEIRRVCSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGTAGAGGAAACTCTGTTCTTGCTGTGGTTTTTCTTCTTTTGTTTGCCGGGAATGTGGAGGTCATTGGCCAGAGCAGTGGATTGCGAGTGGGATTCTACTCGAGATCGTGCCGC
AATGTAGAACCCATTGTTAGAGGTGTGGTGCAGAGGTTTCTCGGTAGGGATAGGACGGTCACGGCGGCACTGCTGCGGCTCTTCTTCCACGATTGCTTCGTCCGA
GTAAGTTTCCTGGCG
ATGGATAGTATCTCAATCGATCGAGAGAGAGGAGATGATAGTTTGGTATGATACTTCATTTCCTCTTGGCAGGGATGCGATGCTTCTTTGTTGCTCAACTCCACGAGAACCAACCGTTCC
GAGAAGGAGCACGGAGCAAACGGGAGCGTCCGGGGGTATGATCTTATCGACGCCGCCAAGGCCGAGGTGGAGAGGCAATGCCGGGGGGTTGTCTCGTGTGCCGATATCGTGGCATTGGCG
ACGAGAGATTCGATCGCCCTG
GTGAGTCTAGAGGCGTTCCTTGGATTGATTGAACACCATGGTGGTTTTGTTTCGATCGAGCAGGCTGGAGGTCCAGACTACCCCGTTCCAACCGGGCGG
AGGGACGGGAGAATCTCCATCGTGAACGACGCAGACGTCTTGCCGGATCCAAACAGCAATGCCAACGGTGCCATCCAAGCCTTCGCAAACAAGGGCCTCACTCCGCAAGACCTTGTTCTC
CTCCTGG
GTATGTACGGAAAGAACTTTGGGACTCCTCCGTGAACCCCGGAAAAATGATCATTTTCTTGTTGTCAATGAATGTAGGCGCTCACACTGTCGGAATTACGCACTGCGGCTTCT
TTCGCCACCGCCTCTTCAACTTCCGCGGCACCGGGCGAGCGGACCCGAGCATGGATCCGGCGCTGGTGAGGCAGCTCCAGCGCGCTTGCACCTCAGACTCGGTGGAAGTTTTCCTCGACC
AAGGAACTCCATTCCGGGTGGACAAGGTCTTCTTTGATCAGCTCGTCTCCAACCGGGCGATCCTCATCATCGACCAGCAGCTCCGGGTGGAGCAAAGAACCGACGACATCGTCCGCGCGC
TTGCAAACGGCACGCTCAACTTCAACGCCGCGTTCGCGCAGTCCATGACCAATATGGGCAACTTGGATGTGCTCACGGGCACGCGCGGCGAGATTCGAAGAGTCTGCAGCGCTGTGAACT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGTAGAGGAAACTCTGTTCTTGCTGTGGTTTTTCTTCTTTTGTTTGCCGGGAATGTGGAGGTCATTGGCCAGAGCAGTGGATTGCGAGTGGGATTCTACTCGAGATCGTGCCGC
AATGTAGAACCCATTGTTAGAGGTGTGGTGCAGAGGTTTCTCGGTAGGGATAGGACGGTCACGGCGGCACTGCTGCGGCTCTTCTTCCACGATTGCTTCGTCCGA
GGATGCGATGCTTCT
TTGTTGCTCAACTCCACGAGAACCAACCGTTCCGAGAAGGAGCACGGAGCAAACGGGAGCGTCCGGGGGTATGATCTTATCGACGCCGCCAAGGCCGAGGTGGAGAGGCAATGCCGGGGG
GTTGTCTCGTGTGCCGATATCGTGGCATTGGCGACGAGAGATTCGATCGCCCTG
GCTGGAGGTCCAGACTACCCCGTTCCAACCGGGCGGAGGGACGGGAGAATCTCCATCGTGAACGAC
GCAGACGTCTTGCCGGATCCAAACAGCAATGCCAACGGTGCCATCCAAGCCTTCGCAAACAAGGGCCTCACTCCGCAAGACCTTGTTCTCCTCCTGG
GCGCTCACACTGTCGGAATTACG
CACTGCGGCTTCTTTCGCCACCGCCTCTTCAACTTCCGCGGCACCGGGCGAGCGGACCCGAGCATGGATCCGGCGCTGGTGAGGCAGCTCCAGCGCGCTTGCACCTCAGACTCGGTGGAA
GTTTTCCTCGACCAAGGAACTCCATTCCGGGTGGACAAGGTCTTCTTTGATCAGCTCGTCTCCAACCGGGCGATCCTCATCATCGACCAGCAGCTCCGGGTGGAGCAAAGAACCGACGAC
ATCGTCCGCGCGCTTGCAAACGGCACGCTCAACTTCAACGCCGCGTTCGCGCAGTCCATGACCAATATGGGCAACTTGGATGTGCTCACGGGCACGCGCGGCGAGATTCGAAGAGTCTGC
AGCGCTGTGAACTAA

Retrieve as FASTA