Entry information : SmPrx21-2_30 (SmPrx21b_30)
Entry ID 7009
Creation 2009-12-02 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx21-2_30 (SmPrx21b_30)
Name (synonym) SmPrx21-2_30 (SmPrx21b_30)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx21-2_30
start..stop
S start..stop
SmPrx21-1_79 672 0 1..328 1..328
GbPrx05 414 2e-146 10..327 17..336
PabPrx86 406 3e-143 7..328 4..327
PsiPrx02 392 1e-137 4..327 10..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 687072..687287 216 N° 2 686798..686992 195 N° 3 686521..686686 166 N° 4 686061..686470 410
complement(join(686061..686470,686521..686686,686798..686992,687072..687287))


exon

Literature and cross-references SmPrx21-2_30 (SmPrx21b_30)
DNA ref. Phytozome 11:   scaffold_30 (687287..686061)
mRNA ref. JGI transcript:   104905
Protein sequence: SmPrx21-2_30 (SmPrx21b_30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   34952.67 (32393.2)  
PI (pH):   %s   7.38 (7.36) Peptide Signal:   %s   cut: 26 range:26-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLVPVQASCLVALLLLLLFGSGIHAQLSPGYYSSSCPNVESIIQQVMLQKFKITPNSVPGTLRLFFHDCFVDGCDASVLIASTASNSAEKDAEINLSLAGDSFDSVIKAKAAVEEKCPGVVSCADILAIATRDLVVLAGGPSWTVRKGRKDGKISQASRVDGNLPKPEQSVDQLTKLFASKGLSQTDMVALSGAHTIGFAHCKEFMSRIYNFNSTHQFDPAMDPNFAKDLRLTCPQSVDPRVVANNDVTTPAKFDNVYYQNAVRGVTVLASDQILHSDARTRGLVTAYAGQQGAFFAAFATAMDNLGAVGVKTGNQGEIRKDCSRFNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTAGTACCAGTCCAGGCCTCTTGTCTTGTTGCTTTGCTGCTGCTACTCCTCTTTGGATCCGGCATTCATGCCCAGCTCTCTCCAGGCTACTACAGCAGCTCCTGCCCCAATGTGGAG
TCTATCATCCAGCAAGTGATGCTCCAGAAGTTCAAGATCACACCCAACAGCGTCCCTGGCACGCTGCGGCTCTTCTTCCACGACTGCTTTGTCGAT
GTAAGTCCAATCTCCCTGTAAGTT
CTATCGCCTTCCTTCGTCCCAAAGGTCTGAGTTTTCGAATGGAATTCGGCCGCAGGGATGCGATGCCTCGGTGCTCATCGCTTCCACGGCCAGCAACAGCGCAGAGAAGGATGCCGAGAT
CAACTTGTCGCTGGCAGGCGATAGCTTCGACTCGGTCATCAAAGCCAAAGCTGCTGTTGAGGAGAAGTGCCCCGGGGTCGTCTCTTGCGCGGACATTCTCGCCATTGCCACCAGGGACCT
CGTTGTGCTG
GTGAGTGATTCTCCTCCATCTTATCTTCGTGTCCAAGGAAAAAAAAATCCTTTTTTTCCCTTGGTCTTTGTCCTCCGAGTTTTTTTCTTGCATTGATTGTCGGGATGGCA
GGCAGGAGGACCATCTTGGACAGTGAGGAAAGGCCGCAAAGATGGAAAGATCTCGCAAGCTTCAAGAGTCGATGGTAACTTGCCAAAGCCCGAGCAATCGGTCGACCAGCTCACCAAGCT
CTTCGCTTCCAAAGGACTCTCTCAAACGGACATGGTGGCTCTCTCAG
GTAAACTCCCTTCTCCTTCCTCTATCAAACTCACCAAAGAAATCTCTCAGGAGCTCACACCATCGGCTTCGCT
CACTGCAAGGAATTCATGAGCCGGATCTACAACTTCAACAGCACTCACCAATTCGATCCCGCAATGGATCCCAACTTCGCCAAGGATTTGCGGCTCACTTGCCCCCAGTCAGTGGATCCA
AGAGTGGTTGCCAACAACGACGTGACCACCCCCGCCAAATTCGACAATGTCTACTACCAAAACGCTGTGAGAGGAGTCACGGTGCTCGCCTCGGACCAAATCCTCCACAGCGACGCTAGA
ACAAGGGGCCTCGTCACGGCATACGCCGGCCAGCAGGGCGCATTCTTCGCCGCGTTCGCTACCGCCATGGACAACCTGGGAGCCGTCGGCGTCAAGACTGGAAACCAGGGAGAAATCCGA
AAGGACTGCTCCAGATTCAACAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTAGTACCAGTCCAGGCCTCTTGTCTTGTTGCTTTGCTGCTGCTACTCCTCTTTGGATCCGGCATTCATGCCCAGCTCTCTCCAGGCTACTACAGCAGCTCCTGCCCCAATGTGGAG
TCTATCATCCAGCAAGTGATGCTCCAGAAGTTCAAGATCACACCCAACAGCGTCCCTGGCACGCTGCGGCTCTTCTTCCACGACTGCTTTGTCGAT
GGATGCGATGCCTCGGTGCTCATC
GCTTCCACGGCCAGCAACAGCGCAGAGAAGGATGCCGAGATCAACTTGTCGCTGGCAGGCGATAGCTTCGACTCGGTCATCAAAGCCAAAGCTGCTGTTGAGGAGAAGTGCCCCGGGGTC
GTCTCTTGCGCGGACATTCTCGCCATTGCCACCAGGGACCTCGTTGTGCTG
GCAGGAGGACCATCTTGGACAGTGAGGAAAGGCCGCAAAGATGGAAAGATCTCGCAAGCTTCAAGAGTC
GATGGTAACTTGCCAAAGCCCGAGCAATCGGTCGACCAGCTCACCAAGCTCTTCGCTTCCAAAGGACTCTCTCAAACGGACATGGTGGCTCTCTCAG
GAGCTCACACCATCGGCTTCGCT
CACTGCAAGGAATTCATGAGCCGGATCTACAACTTCAACAGCACTCACCAATTCGATCCCGCAATGGATCCCAACTTCGCCAAGGATTTGCGGCTCACTTGCCCCCAGTCAGTGGATCCA
AGAGTGGTTGCCAACAACGACGTGACCACCCCCGCCAAATTCGACAATGTCTACTACCAAAACGCTGTGAGAGGAGTCACGGTGCTCGCCTCGGACCAAATCCTCCACAGCGACGCTAGA
ACAAGGGGCCTCGTCACGGCATACGCCGGCCAGCAGGGCGCATTCTTCGCCGCGTTCGCTACCGCCATGGACAACCTGGGAGCCGTCGGCGTCAAGACTGGAAACCAGGGAGAAATCCGA
AAGGACTGCTCCAGATTCAACAGCTAG

Retrieve as FASTA