Entry information : ZmPrx17
Entry ID 713
Creation 2009-01-13 (Christophe Dunand)
Last sequence changes 2009-01-13 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: ZmPrx17
Name ZmPrx17
Class Class III peroxidase    [Orthogroup: Prx132]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Silks
Inducers Fusarium infection
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx17
start..stop
S start..stop
SbPrx21 568 0 18..329 19..331
SiPrx151 525 0 18..329 26..339
BdiPrx47 478 2e-171 20..329 24..328
OsPrx37 457 3e-163 18..329 20..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31207028..31207237 210 N° 2 31207351..31207542 192 N° 3 31207684..31207846 163 N° 4 31207961..31208385 425
join(31207028..31207237,31207351..31207542,31207684..31207846,31207961..31208385 )


exon

Literature and cross-references ZmPrx17
Literature Hainey,C.F. et al., unpublished.
DNA ref. GenBank:   AC190506.1 (101430..102789)
EST ref. GenBank:   DR906573.1 [Fragment]   EY254361.1 [Fragment]
Protein sequence: ZmPrx17
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (307)
PWM (Da):   %s   35372.35 (33429.3)  
PI (pH):   %s   4.6 (4.65) Peptide Signal:   %s   cut: 23 range:23-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAVAVALCAAFALAALGGAEAQQLSPAYYDDSCPHVYDTVRRVIQEARASDPRILASLLRLHFHDCFVNGCDASLLLDETPTMRSEKEANPNKGSARGFPVVDDIKAALENACPGVVSCADVLALAAEVSVELAGGPYWRVMLGRTDGMAANFDGAQNLPNPTEPLNDLKQKFADLGLDDTDFVALQGAHTIGRAQCRFFQDRLYNFSDTERSDPTLDRSYLAALRESCPAAVSDNTCLNNLDPATPDTFDNRYYANILSNRGLLRSDQAMLSAPEEGAVSTAPIVGRFANSQVEFFQSFATAMVKMGNIAPMTGGLREVRRNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 2 ESTs (EY254361.1, DR906573.1). Cultivar="A188", "B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGTGGCCGTAGCCCTGTGCGCGGCGTTCGCGCTCGCGGCGCTCGGCGGCGCCGAGGCGCAGCAGCTCAGCCCGGCGTACTACGACGACTCGTGCCCGCACGTCTACGACACG
GTGCGGCGCGTGATCCAGGAGGCGCGCGCCTCCGATCCGCGCATCCTCGCCAGCCTCCTTCGTCTCCACTTCCACGACTGCTTCGTCAAT
GTATGTGCCCATGCATGGGGCTACGCTAAC
TTATTCCTCAGTTGGTCTGGTCGCCGTGTGCTAATGGATCTGGCTCTGAACGTCGCTCGATTGACCGTGTCGTGCTCATGCAGGGCTGTGACGCGTCGCTGCTGCTCGACGAGACCCCGA
CGATGCGCAGCGAGAAGGAAGCCAACCCCAACAAGGGCTCTGCGCGAGGGTTCCCCGTGGTGGACGACATCAAGGCCGCCCTAGAGAACGCCTGCCCAGGCGTCGTTTCCTGCGCCGACG
TCCTCGCCCTGGCAGCCGAGGTCTCCGTTGAGCTG
GTCAGTCCCCTGACACGACATGCGTGTACAGACGGTGTGCGACAACGCACATGAAGCTGCCGTCGATGGAGAGCAACTGCGACAC
TGCGGTTAGGGATTGCTGCTAATACCGTCTTTTCTGACCGGATATGGTTTGAACAGGCAGGAGGTCCGTACTGGAGGGTGATGCTGGGCCGGACGGACGGCATGGCGGCCAACTTCGACG
GTGCCCAGAACCTTCCAAACCCGACGGAACCGCTGAACGATCTGAAGCAGAAGTTCGCCGACCTCGGCCTCGACGACACCGATTTTGTGGCCCTCCAAG
GTATTCCACTTCAGCCAGCAC
ACATGGAAACGACACGCCAACAGCTAGCCGATCTTCTTGTGGCGGCGCGCGCGCGTGCTGAACTTAGAATGATGCGCCTCGTTGCGTATGCAGGGGCACACACGATCGGCCGCGCCCAGT
GCAGGTTCTTCCAGGACAGGCTCTACAACTTCAGCGACACGGAACGGTCGGACCCGACGCTGGATAGGTCCTACCTCGCCGCGCTCCGGGAGAGCTGTCCGGCGGCGGTGAGCGACAACA
CGTGCCTGAACAACCTGGACCCGGCCACGCCGGACACGTTCGACAACCGCTACTACGCCAACATCCTCAGCAACCGCGGCCTGCTCAGGTCCGACCAGGCCATGCTCTCCGCGCCGGAGG
AGGGCGCGGTGTCCACCGCGCCGATCGTCGGGCGGTTTGCCAACAGCCAGGTCGAGTTCTTCCAAAGCTTCGCCACGGCCATGGTCAAGATGGGGAACATCGCGCCAATGACCGGGGGGC
TCCGGGAGGTCAGGAGAAACTGCAGGGTGGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGTGGCCGTAGCCCTGTGCGCGGCGTTCGCGCTCGCGGCGCTCGGCGGCGCCGAGGCGCAGCAGCTCAGCCCGGCGTACTACGACGACTCGTGCCCGCACGTCTACGACACG
GTGCGGCGCGTGATCCAGGAGGCGCGCGCCTCCGATCCGCGCATCCTCGCCAGCCTCCTTCGTCTCCACTTCCACGACTGCTTCGTCAAT
GGCTGTGACGCGTCGCTGCTGCTCGACGAG
ACCCCGACGATGCGCAGCGAGAAGGAAGCCAACCCCAACAAGGGCTCTGCGCGAGGGTTCCCCGTGGTGGACGACATCAAGGCCGCCCTAGAGAACGCCTGCCCAGGCGTCGTTTCCTGC
GCCGACGTCCTCGCCCTGGCAGCCGAGGTCTCCGTTGAGCTG
GCAGGAGGTCCGTACTGGAGGGTGATGCTGGGCCGGACGGACGGCATGGCGGCCAACTTCGACGGTGCCCAGAACCTT
CCAAACCCGACGGAACCGCTGAACGATCTGAAGCAGAAGTTCGCCGACCTCGGCCTCGACGACACCGATTTTGTGGCCCTCCAAG
GGGCACACACGATCGGCCGCGCCCAGTGCAGGTTC
TTCCAGGACAGGCTCTACAACTTCAGCGACACGGAACGGTCGGACCCGACGCTGGATAGGTCCTACCTCGCCGCGCTCCGGGAGAGCTGTCCGGCGGCGGTGAGCGACAACACGTGCCTG
AACAACCTGGACCCGGCCACGCCGGACACGTTCGACAACCGCTACTACGCCAACATCCTCAGCAACCGCGGCCTGCTCAGGTCCGACCAGGCCATGCTCTCCGCGCCGGAGGAGGGCGCG
GTGTCCACCGCGCCGATCGTCGGGCGGTTTGCCAACAGCCAGGTCGAGTTCTTCCAAAGCTTCGCCACGGCCATGGTCAAGATGGGGAACATCGCGCCAATGACCGGGGGGCTCCGGGAG
GTCAGGAGAAACTGCAGGGTGGTGAACTGA

Retrieve as FASTA