Entry information : SbPrx05 (Sobic.001G189200.1[2.1] / SB01G016620[1.4])
Entry ID 7148
Creation 2010-01-11 (Christophe Dunand)
Last sequence changes 2010-01-11 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-01 (Messaoudi)
Peroxidase information: SbPrx05 (Sobic.001G189200.1[2.1] / SB01G016620[1.4])
Name (synonym) SbPrx05 (Sobic.001G189200.1[2.1] / SB01G016620[1.4])
Class Class III peroxidase    [Orthogroup: Prx059]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx05
start..stop
S start..stop
ZmPrx113 520 0 1..338 31..356
SiPrx167 498 2e-179 26..338 23..333
SpolPrx28 335 6e-115 11..337 5..326
LuPrx100 334 1e-114 9..337 2..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16771185..16771406 222 N° 2 16770296..16771090 795  
complement(join(16770296..16771090,16771185..16771406))


exon

Literature and cross-references SbPrx05 (Sobic.001G189200.1[2.1] / SB01G016620[1.4])
DNA ref. Phytozome 12:   chromosome_1 (16771406..16770296)
Protein sequence: SbPrx05 (Sobic.001G189200.1[2.1] / SB01G016620[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (313)
PWM (Da):   %s   36058.79 (33480.2) Transmb domain:   %s   i12-34o
PI (pH):   %s   9.89 (9.46) Peptide Signal:   %s   cut: 26 range:26-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLLPRRSLLLLLLLAVHAAAASASAALQLHFYARSCPRAEALVRRAVRRRAAHDRSVLPALIRLHFHDCFVRGCDGSVLIDSTPGHPAEKDAPPNLTLRMLDVIDDAKAAVERSCPGVVSCADIVALAARDAAAMAGKVRYEVPTGRRDGTVSAAAEVNLPSPSASFAEALSAFRAVGLGVLDLTTLLGSHTMGFCHCGLITSRLYSYNRTCESDPAMDPGLLAVLRRRCPPHVATPPQNQNVSRDAVVPMNFVAPLGPFGLDNAFYPSVLAGRAVLQVDQELASSGVARRIVAMFATRPGNFRRQFARSMVKLGSVNVLTGSQGEVRLNCRRFNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCTGCTGCTGCCGCGTCGTTCCCTGCTGCTTCTGTTGCTGCTCGCGGTGCACGCCGCCGCGGCCTCGGCCTCCGCGGCGCTGCAGCTCCACTTCTACGCGCGGTCGTGCCCCCGC
GCCGAGGCCCTCGTCCGCCGCGCCGTCCGCCGCCGCGCCGCGCACGACCGCTCCGTGCTCCCCGCGCTCATCCGCCTGCATTTCCACGACTGCTTCGTCAGG
GTACGTCGTCTGTTGCTC
CGCTGCACGTCCGTCCACATTTTTCGTCGTCGCCTCGATCTGACTGTCATGCCCACCACCACCACGGCACCACCAGGGATGCGACGGCTCCGTGCTCATCGACAGCACGCCGGGCCACCC
GGCCGAGAAGGATGCTCCGCCGAACCTGACGCTGCGGATGCTGGACGTGATCGACGACGCCAAGGCGGCGGTGGAGAGGTCGTGCCCGGGCGTCGTGTCGTGCGCCGACATCGTCGCGCT
GGCCGCCAGGGACGCGGCGGCGATGGCGGGGAAGGTGCGGTACGAGGTGCCGACGGGGAGGAGGGACGGCACCGTGTCCGCCGCCGCCGAGGTGAACCTGCCCAGCCCGTCCGCGTCGTT
CGCCGAGGCTCTGTCGGCGTTCCGCGCCGTAGGCCTCGGCGTGCTCGACCTCACCACCTTGCTGGGCTCCCACACCATGGGGTTCTGCCACTGCGGGCTCATCACGAGCAGGCTCTACAG
CTACAACCGCACCTGCGAGTCCGACCCGGCCATGGACCCCGGCCTGCTGGCCGTGCTCCGGCGCCGGTGCCCGCCGCACGTGGCGACGCCGCCGCAGAACCAGAACGTGTCCCGCGACGC
GGTCGTGCCCATGAACTTCGTCGCGCCGCTCGGCCCGTTCGGCCTCGACAACGCGTTCTACCCGAGCGTGCTCGCCGGGAGAGCCGTGCTGCAGGTCGACCAGGAGCTCGCGTCCTCCGG
CGTCGCCCGCCGGATCGTGGCCATGTTCGCGACGCGGCCGGGGAACTTCCGGAGGCAGTTCGCGAGGTCCATGGTGAAGCTGGGGAGTGTCAACGTTCTCACGGGGAGCCAAGGGGAGGT
CAGGCTCAACTGTCGAAGGTTTAACAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCTGCTGCTGCCGCGTCGTTCCCTGCTGCTTCTGTTGCTGCTCGCGGTGCACGCCGCCGCGGCCTCGGCCTCCGCGGCGCTGCAGCTCCACTTCTACGCGCGGTCGTGCCCCCGC
GCCGAGGCCCTCGTCCGCCGCGCCGTCCGCCGCCGCGCCGCGCACGACCGCTCCGTGCTCCCCGCGCTCATCCGCCTGCATTTCCACGACTGCTTCGTCAGG
GGATGCGACGGCTCCGTG
CTCATCGACAGCACGCCGGGCCACCCGGCCGAGAAGGATGCTCCGCCGAACCTGACGCTGCGGATGCTGGACGTGATCGACGACGCCAAGGCGGCGGTGGAGAGGTCGTGCCCGGGCGTC
GTGTCGTGCGCCGACATCGTCGCGCTGGCCGCCAGGGACGCGGCGGCGATGGCGGGGAAGGTGCGGTACGAGGTGCCGACGGGGAGGAGGGACGGCACCGTGTCCGCCGCCGCCGAGGTG
AACCTGCCCAGCCCGTCCGCGTCGTTCGCCGAGGCTCTGTCGGCGTTCCGCGCCGTAGGCCTCGGCGTGCTCGACCTCACCACCTTGCTGGGCTCCCACACCATGGGGTTCTGCCACTGC
GGGCTCATCACGAGCAGGCTCTACAGCTACAACCGCACCTGCGAGTCCGACCCGGCCATGGACCCCGGCCTGCTGGCCGTGCTCCGGCGCCGGTGCCCGCCGCACGTGGCGACGCCGCCG
CAGAACCAGAACGTGTCCCGCGACGCGGTCGTGCCCATGAACTTCGTCGCGCCGCTCGGCCCGTTCGGCCTCGACAACGCGTTCTACCCGAGCGTGCTCGCCGGGAGAGCCGTGCTGCAG
GTCGACCAGGAGCTCGCGTCCTCCGGCGTCGCCCGCCGGATCGTGGCCATGTTCGCGACGCGGCCGGGGAACTTCCGGAGGCAGTTCGCGAGGTCCATGGTGAAGCTGGGGAGTGTCAAC
GTTCTCACGGGGAGCCAAGGGGAGGTCAGGCTCAACTGTCGAAGGTTTAACAGCTGA

Retrieve as FASTA