Entry information : MicaAPx-CcP01
Entry ID 7154
Creation 2010-01-12 (Marcel Zamocky)
Last sequence changes 2011-01-17 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-04-10 (Christophe Dunand)
Peroxidase information: MicaAPx-CcP01
Name MicaAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Arthrodermataceae Arthroderma
Organism Microsporum canis (Arthroderma otae)     [TaxId: 63405 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MicaAPx-CcP01
start..stop
S start..stop
AgyAPx-CcP01 1280 0 1..739 1..739
TrubrAPx-CcP01 1258 0 6..740 6..740
TtoAPx-CcP1_CBS112818 1246 0 6..740 6..740
TeqAPx-CcP1 1237 0 6..740 6..740
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 594256..595386 1131 N° 2 595458..595658 201 N° 3 595719..596615 897  
join(594256..595386,595458..595658,595719..596615)


exon

Literature and cross-references MicaAPx-CcP01
Literature Cuomo C.A., et al. Annotation of Microsporum canis strain CBS 113480. Submitted (OCT-2008) to the EMBL/GenBank/DDBJ databases
Protein ref. UniProtKB:   C5G163
DNA ref. GenBank:   DS995709.1 (594256..596615)
Protein sequence: MicaAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   742 (723)
PWM (Da):   %s   78999.79 (76967.7)  
PI (pH):   %s   4.55 (4.52) Peptide Signal:   %s   cut: 20 range:20-742
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPYPRAIVWTAFALSGSLALPTWPSAIDELEDLMFLNTGYHARGFSAGVTPCSFSQQGPSRIASAEWIRTAFHDMATGNVFTGVGGLDASIQYELAGNGGENIGAAFNTTLETFTPFFSPRSSMADLIALGIYTAVRSCGGPVVKIRAGRIDATERGAFGVPQPENSQGTFINQFARTGFNVSDMIAVTACGHTMGGVHASNFPQITVPGTVPNDFQLFDSTIAFDERIAADFVGGVTGNPLTGMTAKRNSRDSDTKVFTADRNVTIAALADPTTFQATCARVLQKMIEVVPSGVNLTAPIEPYEVKPSRLQLSLAGNGSTIDFSGEIRVRTTTRPLTSISKAEIVYKDRLGGSDCGSCIISTEYKGAAEGFDDSFAFYGFSTSVPVETSISRFNVRIVLNTGEAIIYDNNGSGYPVQDTIMFQPKQSCVLGDNIPGNFVVVAAVRDTANSPRVTLSVTKKIPRSCCVTPALTTQTVPMLSQTTIGLYTLYSGNYSLAAVSKSSTKFDISLSSDGATVSDSFKNTADLGSTCVPFGSNGTTVPDYTFDGCYTDSPESRTLTGAAFVDGNMTVTACSSLCKGYQFFGLEYGIECYCGNSRSNATMQAPESECNQPCGGDNSETCGASYRVGIYKDNTWIPTTNPQIPGYDYSGCFNDSASARALSDSFVYNEKMTVELCATFCNGTKYFGTEYFSECYCGANLSPESTLKAEADCSLFCSGNNTQYCGGSNRINLYTKTEMFR*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Peroxidase domain fused to 2 WSC domains (putative carbohydrate binding domain). Strain="CBS 113480".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCTACCCCAGGGCCATCGTATGGACAGCTTTTGCTCTTTCCGGAAGTCTGGCTCTGCCAACATGGCCCTCCGCTATCGACGAGCTAGAAGATCTCATGTTTCTCAACACTGGCTAC
CATGCACGAGGATTCTCTGCCGGCGTCACTCCATGTTCATTCTCCCAGCAGGGACCGTCTCGGATTGCGTCTGCTGAGTGGATTCGCACTGCTTTTCATGACATGGCTACCGGTAACGTT
TTTACAGGTGTTGGTGGACTGGACGCATCCATCCAGTATGAGCTTGCCGGGAATGGGGGAGAAAATATAGGAGCTGCGTTCAATACGACGTTGGAGACTTTCACGCCCTTCTTCTCGCCG
AGATCGTCCATGGCTGACTTGATTGCGCTTGGGATATACACTGCTGTGCGGTCTTGCGGCGGCCCGGTTGTAAAGATCAGGGCTGGGAGAATCGATGCAACCGAACGGGGCGCATTCGGC
GTGCCGCAGCCTGAGAACTCCCAGGGAACATTCATTAACCAGTTTGCCCGGACGGGATTCAATGTCTCGGACATGATCGCTGTCACAGCGTGCGGACATACCATGGGGGGAGTTCATGCC
TCGAACTTCCCTCAGATCACTGTTCCGGGGACGGTGCCAAATGACTTTCAGCTGTTTGACTCAACCATCGCGTTTGACGAGAGGATAGCAGCAGACTTTGTTGGCGGAGTGACAGGCAAC
CCCCTTACCGGCATGACTGCGAAGAGGAACTCTCGAGACTCTGATACAAAAGTCTTCACAGCGGATCGGAATGTTACTATCGCGGCGCTGGCTGACCCAACAACCTTTCAGGCTACTTGC
GCCAGAGTACTGCAGAAGATGATAGAAGTTGTCCCATCAGGAGTTAATCTGACGGCTCCAATTGAGCCTTATGAGGTGAAGCCGAGCAGACTGCAGCTCTCTCTGGCTGGCAACGGCAGC
ACGATCGATTTCTCTGGCGAAATCCGGGTTAGAACCACCACCAGACCGCTTACCTCTATCTCAAAGGCCGAGATTGTGTATAAAGACCGCCTCGGAGGCTCAGACTGCGGATCCTGTATC
ATCAGTACCGAGTACAAGGGCGCCGCTGAAGGCTTTGATGATTCTTTTGCT
GTAACCAATTCCTCCCAGCTCCACCCCTTTTATTTTCAACTAGCTAGTATTAATGCTGACAATGGCGCC
AGTTCTACGGATTCTCTACCAGTGTCCCAGTAGAGACATCTATCTCCCGGTTCAACGTACGGATAGTCTTGAACACGGGGGAGGCCATTATATATGACAACAATGGGTCCGGATATCCTG
TTCAGGATACGATCATGTTTCAGCCTAAGCAGAGCTGTGTATTAGGAGACAATATTCCTGGTAACTTTGTCGTAGTAGCTGCT
GTATGGCCATTTACCCACCCTCGATATATTTATCATA
AAACATAAGCTGATGGCTCCAAGGTCCGAGACACCGCAAATTCTCCCAGAGTGACCCTCTCTGTTACTAAAAAAATACCACGGAGTTGCTGTGTTACTCCTGCTTTGACGACTCAGACGG
TACCAATGCTATCACAAACGACCATTGGTTTATATACACTCTACTCTGGAAATTATTCGCTCGCAGCTGTGTCTAAATCCAGCACGAAGTTCGACATCTCCCTCTCAAGCGACGGGGCAA
CGGTATCGGATTCGTTCAAGAACACCGCTGACTTAGGGTCGACGTGCGTGCCTTTTGGCTCTAACGGTACAACTGTGCCAGATTATACCTTTGACGGATGTTATACCGATAGCCCAGAGT
CTAGGACACTCACAGGAGCTGCGTTTGTAGACGGAAACATGACCGTTACCGCTTGCTCCAGCTTGTGTAAAGGCTACCAGTTTTTTGGCCTTGAATATGGAATCGAGTGCTATTGCGGGA
ACTCAAGGAGTAACGCAACCATGCAAGCACCCGAATCTGAATGCAACCAGCCTTGCGGCGGTGACAACTCTGAGACTTGTGGTGCATCTTATCGCGTTGGTATCTATAAGGATAACACAT
GGATTCCGACAACCAACCCCCAGATCCCAGGTTACGACTATTCTGGGTGCTTCAACGATTCGGCCAGCGCTCGTGCGCTGTCAGACAGCTTCGTGTACAACGAGAAGATGACGGTGGAAC
TATGTGCCACATTTTGCAACGGCACGAAGTACTTTGGGACTGAATACTTCAGCGAGTGCTACTGCGGAGCCAATCTGTCCCCAGAGAGCACTCTGAAAGCCGAGGCGGATTGTAGTTTAT
TCTGCTCCGGGAACAATACTCAGTATTGCGGCGGAAGTAACAGGATAAACTTATATACAAAGACTGAAATGTTCAGGTAG

Retrieve as FASTA