Entry information : MperAPx-CcP01
Entry ID 7155
Creation 2010-01-12 (Marcel Zamocky)
Last sequence changes 2011-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-08-11 (Christophe Dunand)
Peroxidase information: MperAPx-CcP01
Name MperAPx-CcP01
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Marasmiaceae Moniliophthora
Organism Moniliophthora perniciosa    [TaxId: 153609 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MperAPx-CcP01
start..stop
S start..stop
MfiaAPx-CcP02 506 9e-178 11..426 15..430
SsclAPx-CcP01 382 9e-129 1..426 1..421
CfioAPx-CcP01_PJ7 381 9e-129 1..427 1..426
CfioAPx-CcP01_MH18 379 6e-128 1..427 1..426
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 517..1074 558 N° 2 1138..1731 594 N° 3 1791..1925 135  
join(517..1074,1138..1731,1791..1925)


exon

Literature and cross-references MperAPx-CcP01
Literature Mondego,J.M., Cet al;, A genome survey of Moniliophthora perniciosa gives new insights into Witches' Broom Disease of cacao. BMC Genomics 9, 548 (2008)
Protein ref. GenBank:   EEB89476
DNA ref. GenBank:   ABRE01017392
Protein sequence: MperAPx-CcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   428 (410)
PWM (Da):   %s   46506.83 (44548.7)  
PI (pH):   %s   4.49 (4.41) Peptide Signal:   %s   cut: 19 range:19-428
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRANLALAHILLPFLVNAYTWPSPIDELEDIMYLQGGYFRRGFHDGVLGCTFSPSFSPFRQASAEWLRTAFHDAITHDTSTGTGGVDASLRYELDRPENVGAIALNGTFGFFSGFQTVRSSMADLVALGVYTAVRECGGPVVKFRAGRIDAKGPGEAGVPEPQTDLEETTRRFEKAGFNVEDMIAMVACGHTIGGVHGNDFPEITGNNSEESFPKFDSTNAGFDSQVVTEYLAGNTTNVLVVGPDVTSSDRRIFGGKMSASVQIGRMLIVIVASDNNATMNTLADPGTFRATCADILQRMVDTVPSSVTLTDPIEPIDVKPANLKFYVTSEGTLRFEGQIRIRWTERAGDPPPAVQLRYEGGVIEAIKATFQGGIGQGFDDWFQFYEFQHSLQPNTSLSSFTVEFNDEVHTNGGSGFPIHDEVWVQHL*

Retrieve as FASTA  
Remarks Complete sequence from genomic. strain="FA553".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCCAACCTCGCCCTCGCTCACATTCTCCTCCCGTTCCTTGTTAATGCTTACACCTGGCCGTCACCCATAGATGAGCTAGAAGACATCATGTACCTCCAAGGAGGATACTTCCGC
CGAGGATTCCACGACGGCGTGCTAGGCTGCACTTTTTCGCCTTCATTCTCTCCATTCCGCCAAGCCTCTGCTGAATGGTTGCGCACAGCCTTCCACGATGCCATTACTCACGATACGTCC
ACCGGTACTGGCGGTGTCGATGCCTCCCTTCGTTACGAGCTAGATAGGCCGGAAAATGTGGGTGCTATTGCGCTGAACGGCACATTCGGTTTCTTTAGCGGATTCCAAACCGTCCGATCC
AGTATGGCGGATTTGGTAGCGCTGGGAGTATACACTGCTGTCAGGGAGTGCGGTGGACCTGTTGTGAAGTTCAGAGCCGGGAGAATTGATGCAAAGGGACCAGGAGAGGCCGGCGTACCG
GAGCCACAAACAGACTTGGAGGAGACCACGCGGAGGTTCGAGAAGGCGGGTTTCAATGTAGAGGATATGATTGCTATG
GTATGTGGTATATTCTAACCGTACTGTTGCGAACCGGATTGC
ACTAATTGGCCGCTTTACCAGGTTGCATGTGGACACACGATTGGCGGCGTTCATGGGAACGATTTCCCCGAAATCACGGGCAACAACAGTGAAGAGAGTTTCCCAAAATTCGACAGTACC
AATGCCGGATTCGATAGTCAGGTCGTAACGGAATATCTTGCCGGAAACACGACCAATGTGCTGGTAGTCGGGCCTGACGTAACCAGTTCGGATAGGCGAATCTTCGGTGGGAAAATGTCA
GCTTCCGTTCAAATAGGAAGAATGCTCATTGTCATCGTAGCCTCCGATAACAACGCAACTATGAACACTCTTGCCGACCCCGGCACCTTCCGAGCAACATGCGCAGATATCCTACAACGA
ATGGTAGACACCGTACCTTCGTCGGTTACGCTTACCGACCCCATCGAACCTATTGATGTAAAACCTGCCAACTTGAAGTTTTACGTGACGAGTGAAGGGACCCTCAGATTCGAAGGTCAG
ATTCGCATTCGTTGGACCGAGAGGGCCGGGGATCCACCTCCAGCGGTGCAATTGCGATACGAGGGAGGCGTCATTGAAGCTATCAAGGCCACATTCCAGGGTGGTATCGGGCAAGGGTTC
GATGACTGGTTCCAG
GTACGGTCTTTCTCCGTCTTCCCTTCTCAGCTTCAGCTTACGAGTATCGTCGCTCCCAGTTCTATGAGTTCCAACACAGCCTACAGCCAAATACCTCTCTGTCCT
CTTTCACTGTCGAGTTCAACGACGAGGTACACACTAATGGTGGCAGCGGTTTCCCGATACACGATGAGGTTTGGGTGCAACATCTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGGCCAACCTCGCCCTCGCTCACATTCTCCTCCCGTTCCTTGTTAATGCTTACACCTGGCCGTCACCCATAGATGAGCTAGAAGACATCATGTACCTCCAAGGAGGATACTTCCGC
CGAGGATTCCACGACGGCGTGCTAGGCTGCACTTTTTCGCCTTCATTCTCTCCATTCCGCCAAGCCTCTGCTGAATGGTTGCGCACAGCCTTCCACGATGCCATTACTCACGATACGTCC
ACCGGTACTGGCGGTGTCGATGCCTCCCTTCGTTACGAGCTAGATAGGCCGGAAAATGTGGGTGCTATTGCGCTGAACGGCACATTCGGTTTCTTTAGCGGATTCCAAACCGTCCGATCC
AGTATGGCGGATTTGGTAGCGCTGGGAGTATACACTGCTGTCAGGGAGTGCGGTGGACCTGTTGTGAAGTTCAGAGCCGGGAGAATTGATGCAAAGGGACCAGGAGAGGCCGGCGTACCG
GAGCCACAAACAGACTTGGAGGAGACCACGCGGAGGTTCGAGAAGGCGGGTTTCAATGTAGAGGATATGATTGCTATG
GTTGCATGTGGACACACGATTGGCGGCGTTCATGGGAACGAT
TTCCCCGAAATCACGGGCAACAACAGTGAAGAGAGTTTCCCAAAATTCGACAGTACCAATGCCGGATTCGATAGTCAGGTCGTAACGGAATATCTTGCCGGAAACACGACCAATGTGCTG
GTAGTCGGGCCTGACGTAACCAGTTCGGATAGGCGAATCTTCGGTGGGAAAATGTCAGCTTCCGTTCAAATAGGAAGAATGCTCATTGTCATCGTAGCCTCCGATAACAACGCAACTATG
AACACTCTTGCCGACCCCGGCACCTTCCGAGCAACATGCGCAGATATCCTACAACGAATGGTAGACACCGTACCTTCGTCGGTTACGCTTACCGACCCCATCGAACCTATTGATGTAAAA
CCTGCCAACTTGAAGTTTTACGTGACGAGTGAAGGGACCCTCAGATTCGAAGGTCAGATTCGCATTCGTTGGACCGAGAGGGCCGGGGATCCACCTCCAGCGGTGCAATTGCGATACGAG
GGAGGCGTCATTGAAGCTATCAAGGCCACATTCCAGGGTGGTATCGGGCAAGGGTTCGATGACTGGTTCCAG
TTCTATGAGTTCCAACACAGCCTACAGCCAAATACCTCTCTGTCCTCT
TTCACTGTCGAGTTCAACGACGAGGTACACACTAATGGTGGCAGCGGTTTCCCGATACACGATGAGGTTTGGGTGCAACATCTCTGA

Retrieve as FASTA